SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


secreted regulator of the activity of phosphatase [protein|BA85E2C2E2A6B76FAFA31EBDBF466324C9B021C8|RapH]
6.30 kDa
protein length
gene length
174 bp Sequence Blast
control of [SW|sporulation] initiation
secreted regulator of the activity of phosphatase [protein|BA85E2C2E2A6B76FAFA31EBDBF466324C9B021C8|RapH]

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Control of two-component response regulators] → [category|SW|Control of response regulators/ other]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay] → [category|SW|Other protein controlling the activity of the phosphorelay]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.8|Quorum sensing]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay] → [category|SW|Other protein controlling the activity of the phosphorelay]
  • [category|SW 6|Groups of genes] → [category|SW 6.8|Short peptides]
  • Gene

    752,079 752,252

    The protein

    Protein family

  • [SW|phr family] (according to UniProt)
  • [SW|Localization]

  • secreted as hexapeptide TDRNTT [Pubmed|21908671], uptake by the ([protein|05752B9C4EA7ACD579D65D028B7DF1861F3840CB|OppD]-[protein|38AD697B6C9967B8BD7496E31264A21F6D0A9DEE|OppF])-([protein|B0A3C7B253FB1DA1D4BC9D1D564905ECE8A65BC1|OppB]-[protein|DDBCE73B6AF39E5D669475479186C93F287DA9FC|OppC])-[protein|302DFA46D73E18C4663468ED6033C55056744475|OppA] [SW|ABC transporter] [Pubmed|21908671]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|21908671], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|972401B6AF56EC67FE6F1C3FEA9E2A9FC77C7672|RghR]: repression, [Pubmed|16553878], in [regulon|972401B6AF56EC67FE6F1C3FEA9E2A9FC77C7672|RghR regulon]
  • regulation

  • ''[protein|search|rapH]'': repressed by [protein|search|RghR] [Pubmed|16553878]
  • view in new tab


    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|21908671], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|972401B6AF56EC67FE6F1C3FEA9E2A9FC77C7672|RghR]: repression, [Pubmed|16553878], in [regulon|972401B6AF56EC67FE6F1C3FEA9E2A9FC77C7672|RghR regulon]
  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, [Pubmed|11948146,11918817], in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • ''[protein|search|rapH]'': repressed by [protein|search|RghR] [Pubmed|16553878]
  • view in new tab

    Biological materials


  • BKE06839 ([gene|4FA7D6E6316A6FC71C10C692D125833263894020|phrH]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGCCAGACACATCATCACTT, downstream forward: _UP4_TAGGGCTTTTTCTTGCTTTA
  • BKK06839 ([gene|4FA7D6E6316A6FC71C10C692D125833263894020|phrH]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGCCAGACACATCATCACTT, downstream forward: _UP4_TAGGGCTTTTTCTTGCTTTA
  • References

  • 16553878