SubtiBank SubtiBank
cwlO
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

cwlO

D,L-endopeptidase-type autolysin, primary autolytic pathway for cell elongation
locus
BSU_34800
pI
5.33
mw
50.87 kDa
protein length
473 aa Sequence Blast
gene length
1422 bp Sequence Blast
function
cell wall synthesis, cell elongation
product
endopeptidase-type autolysin
essential
no
synonyms
yzkA,yvcE

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW 1.1.1.2|Autolytic activity required for peptidoglycan synthesis (cell elongation)]
  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW 1.1.3.1|Autolysis]
  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW 1.1.3.4|Endopeptidases]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    3,574,363 3,575,784

    Phenotypes of a mutant

  • a ''[gene|4F9D70C4BB4FCA809BEAC341C3F8122FB7FD8872|cwlO] [gene|321F248C22D7283C0F3323F1F4069E36F8D7FE6C|lytE]'' mutant is not viable [Pubmed|17581128,22139507]
  • shorter, fatter cells, this can be rescued by addition of Mg(2+) [Pubmed|23869552,23855774]
  • loss of genetic competence [pubmed|29553055]
  • The protein

    Catalyzed reaction/ biological activity

  • cleaves the peptide bond between D-Glu (position 2 in the peptioglycan peptide) and m-diamino pimelic acid (position 3) [Pubmed|18266855]
  • degradation of gamma-polyglutamic acid [pubmed|29458655]
  • Protein family

  • [SW|Peptidase C40 family] (according to UniProt)
  • [SW|Domains]

  • C-terminal D,L-endopeptidase domain ([SW|NlpC/P60 domain]) [pubmed|29458655,22139507]
  • Effectors of protein activity

  • [protein|4F9D70C4BB4FCA809BEAC341C3F8122FB7FD8872|CwlO] requires activation by [protein|8BF7EB539B53D75BD30BD30ABF27106D6A0B030B|FtsE]-[protein|E22D0F0AC56DC95AFC02E7F55FCD5FAA44B6B490|FtsX] [Pubmed|23869552,23855774]
  • activity requires functional [protein|6ED386D49F973C1F6B1076974F54275DD583C9D3|Mbl] [Pubmed|23869552]
  • both enzymatic activities are inhibited by interaction with [protein|0CA55371306D4BD768CFA82027DCB4D581BCCB87|IseA] [pubmed|29458655]
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • localizes to the outer lateral sidewall of the cell (via the N-terminal domain) [Pubmed|22139507]
  • cell membrane in a [protein|E22D0F0AC56DC95AFC02E7F55FCD5FAA44B6B490|FtsX]-dependent manner [Pubmed|23869552]
  • Expression and Regulation

    Operons

    genes
    [gene|4F9D70C4BB4FCA809BEAC341C3F8122FB7FD8872|cwlO]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [pubmed|24163346], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR]: activation, [pubmed|17581128], in [regulon|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR regulon]
  • regulation

  • expressed during exponential growth ([protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR]) [pubmed|17581128]
  • the leader mRNA is processed by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex [Pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • GP2642 ([gene|4F9D70C4BB4FCA809BEAC341C3F8122FB7FD8872|cwlO]::''aphA3''), available in [SW|Jörg Stülke]'s lab
  • MGNA-B643 (yvcE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1642 NBRP B. subtilis, Japan]
  • BKE34800 ([gene|4F9D70C4BB4FCA809BEAC341C3F8122FB7FD8872|cwlO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTTTTATATCCTCCCTT, downstream forward: _UP4_TAATAAATATGACAAGGGCC
  • BKK34800 ([gene|4F9D70C4BB4FCA809BEAC341C3F8122FB7FD8872|cwlO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTTTTATATCCTCCCTT, downstream forward: _UP4_TAATAAATATGACAAGGGCC
  • References

    Reviews

  • 23066944,18266855
  • Original publications

  • 21478646,16233686,17581128,20525796,18957862,20059685,22139507,23855774,23869552,24163346,27118079,29553055,29794222,29458655,29458657,29465029