SubtiBank SubtiBank
cwlO
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

cwlO

D,L-endopeptidase-type autolysin, primary autolytic pathway for cell elongation
locus
BSU34800
pI
5.33
mw
50.87 kDa
protein length
473 aa Sequence Blast
gene length
1422 bp Sequence Blast
function
cell wall synthesis, cell elongation
product
endopeptidase-type autolysin
essential
no
synonyms
yzkA,yvcE

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW 1.1.1.2|Autolytic activity required for peptidoglycan synthesis (cell elongation)]
  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW 1.1.3.1|Autolysis]
  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW 1.1.3.4|Endopeptidases]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    3,574,363 3,575,784

    Phenotypes of a mutant

  • a ''[gene|4F9D70C4BB4FCA809BEAC341C3F8122FB7FD8872|cwlO] [gene|321F248C22D7283C0F3323F1F4069E36F8D7FE6C|lytE]'' mutant is not viable [Pubmed|17581128,22139507]
  • shorter, fatter cells, this can be rescued by addition of Mg(2+) [Pubmed|23869552,23855774]
  • loss of genetic competence [pubmed|29553055]
  • The protein

    Catalyzed reaction/ biological activity

  • cleaves the peptide bond between D-Glu (position 2 in the peptioglycan peptide) and m-diamino pimelic acid (position 3) [Pubmed|18266855]
  • degradation of gamma-polyglutamic acid [pubmed|29458655]
  • Protein family

  • [SW|Peptidase C40 family] (according to UniProt)
  • [SW|Domains]

  • C-terminal D,L-endopeptidase domain ([SW|NlpC/P60 domain]) [pubmed|29458655,22139507]
  • Effectors of protein activity

  • [protein|4F9D70C4BB4FCA809BEAC341C3F8122FB7FD8872|CwlO] requires activation by [protein|8BF7EB539B53D75BD30BD30ABF27106D6A0B030B|FtsE]-[protein|E22D0F0AC56DC95AFC02E7F55FCD5FAA44B6B490|FtsX] [Pubmed|23869552,23855774]
  • activity requires functional [protein|6ED386D49F973C1F6B1076974F54275DD583C9D3|Mbl] [Pubmed|23869552]
  • both enzymatic activities are inhibited by interaction with [protein|0CA55371306D4BD768CFA82027DCB4D581BCCB87|IseA] [pubmed|29458655]
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • localizes to the outer lateral sidewall of the cell (via the N-terminal domain) [Pubmed|22139507]
  • cell membrane in a [protein|E22D0F0AC56DC95AFC02E7F55FCD5FAA44B6B490|FtsX]-dependent manner [Pubmed|23869552]
  • Expression and Regulation

    Operons

    genes
    [gene|4F9D70C4BB4FCA809BEAC341C3F8122FB7FD8872|cwlO]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [pubmed|24163346], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR]: activation, [pubmed|17581128], in [regulon|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR regulon]
  • regulation

  • expressed during exponential growth ([protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR]) [pubmed|17581128]
  • the leader mRNA is processed by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex [Pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • GP2642 ([gene|4F9D70C4BB4FCA809BEAC341C3F8122FB7FD8872|cwlO]::''aphA3''), available in [SW|Jörg Stülke]'s lab
  • MGNA-B643 (yvcE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1642 NBRP B. subtilis, Japan]
  • BKE34800 ([gene|4F9D70C4BB4FCA809BEAC341C3F8122FB7FD8872|cwlO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTTTTATATCCTCCCTT, downstream forward: _UP4_TAATAAATATGACAAGGGCC
  • BKK34800 ([gene|4F9D70C4BB4FCA809BEAC341C3F8122FB7FD8872|cwlO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTTTTATATCCTCCCTT, downstream forward: _UP4_TAATAAATATGACAAGGGCC
  • References

    Reviews

  • 23066944,18266855
  • Original publications

  • 21478646,16233686,17581128,20525796,18957862,20059685,22139507,23855774,23869552,24163346,27118079,29553055,29794222,29458655,29458657,29465029