SubtiBank SubtiBank
nupC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

nupC

pyrimidine nucleoside transport protein
locus
BSU39410
pI
9.32
mw
42.37 kDa
protein length
393 aa Sequence Blast
gene length
1182 bp Sequence Blast
function
pyrimidine uptake
product
pyrimidine nucleoside transport protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.6|Nucleotide/ nucleoside transporter]
  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.1|Utilization of nucleotides]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    4,050,340 4,051,521

    The protein

    Protein family

  • SLC28A transporter family (according to Swiss-Prot)
  • Structure

  • [PDB|3TIJ] (from Vibrio cholerae, 33% identity) [pubmed|22407322]
  • [SW|Localization]

  • membrane protein [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|81CD1F97E887549F7FB742FCEF38B86B84383F5D|dra]-[gene|4F718681A7AD0C86B2551248570F493AC0B2E7E9|nupC]-[gene|D2EB7BBAC8817912DAC4E215879F5A4E2C47ECAF|pdp]
    description
    [Pubmed|8550462]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8550462], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|10666464], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E9C4C569F18B3335DA9C7FB5B17C87D661E62669|DeoR]: repression, [Pubmed|8550462], in [regulon|E9C4C569F18B3335DA9C7FB5B17C87D661E62669|DeoR regulon]
  • regulation

  • induced by deoxynucleotides ([protein|search|DeoR]) [Pubmed|8550462]
  • view in new tab

    Biological materials

    Mutant

  • BKE39410 ([gene|4F718681A7AD0C86B2551248570F493AC0B2E7E9|nupC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39410 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGTGTTTCTCCTTTAT, downstream forward: _UP4_TGAACTTAATCGAAAAGGAT
  • BKK39410 ([gene|4F718681A7AD0C86B2551248570F493AC0B2E7E9|nupC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39410 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGTGTTTCTCCTTTAT, downstream forward: _UP4_TGAACTTAATCGAAAAGGAT
  • References

  • 11065368,8550462,10074062,18763711,10666464,22407322