SubtiBank SubtiBank
yomS
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yomS

similar to phage-related lytic exoenzyme
locus
BSU_21240
pI
4.33
mw
12.76 kDa
protein length
118 aa Sequence Blast
gene length
357 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • Gene

    Coordinates
    2,242,056 2,242,412

    The protein

    Paralogous protein(s)

  • [protein|D55168C206F2B6B79F9F8FCA90A757F6CCE39849|YqxG]: 33% identity to the C-terminal part of [protein|D55168C206F2B6B79F9F8FCA90A757F6CCE39849|YqxG]
  • [protein|27BB6659541BA5368DEDB19EADCD372CE41244F5|XepA]: 38% identity to the C-terminal part of [protein|27BB6659541BA5368DEDB19EADCD372CE41244F5|XepA]
  • Structure

  • [PDB|6I5O] [pubmed|31692476]
  • Biological materials

    Mutant

  • BKE21240 ([gene|4F4F48730C97FBEEEAE6B4080D2DD324C575633E|yomS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACAACTCCACCTCCTTAA, downstream forward: _UP4_GTTAAAGGGATTGTGGTGAG
  • BKK21240 ([gene|4F4F48730C97FBEEEAE6B4080D2DD324C575633E|yomS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACAACTCCACCTCCTTAA, downstream forward: _UP4_GTTAAAGGGATTGTGGTGAG
  • References

    Research papers

  • 31692476