SubtiBank SubtiBank
speE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

speE

spermidine synthase
locus
BSU37500
pI
5.07
mw
31.18 kDa
protein length
276 aa Sequence Blast
gene length
831 bp Sequence Blast
function
spermidine, polyamine biosynthesis
product
spermidine synthase
essential
no
ec
2.5.1.16
synonyms
ywhF

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.6|Metabolism of polyamines]
  • Gene

    Coordinates
    3,848,786 3,849,616

    Phenotypes of a mutant

  • inactivation of ''[gene|4F3E96C741561746B4E0EEA5AE29DB124C2F7249|speE]'' reduces [SW|sporulation] efficiency to 6% that of wild type cells; delayed entry into [SW|sporulation] [Pubmed|26735940]
  • The protein

    Catalyzed reaction/ biological activity

  • S-adenosylmethioninamine + putrescine = 5'-S-methyl-5'-thioadenosine + spermidine (according to Swiss-Prot)
  • Protein family

  • spermidine/spermine synthase family (according to Swiss-Prot)
  • Structure

  • [PDB|1IY9]
  • Expression and Regulation

    Operons

    genes
    [gene|4F3E96C741561746B4E0EEA5AE29DB124C2F7249|speE]-[gene|EA0AA0ECBC4A36A3F01F5876900FE51243D9AD07|speB]
    description
    [Pubmed|9723923]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9723923], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    additional information

  • [SW|Jörg Stülke]'s lab
  • Biological materials

    Mutant

  • MGNA-A521 (ywhF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/521 NBRP B. subtilis, Japan]
  • BKE37500 (''[gene|4F3E96C741561746B4E0EEA5AE29DB124C2F7249|speE]''::''erm'', available in the BGSC and in [SW|Jörg Stülke]'s lab) [pubmed|28189581]
  • BKE37500 ([gene|4F3E96C741561746B4E0EEA5AE29DB124C2F7249|speE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37500 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTGTCATCTCCCTTTCG, downstream forward: _UP4_TAATGAAGGTATGGCGCAGG
  • BKK37500 ([gene|4F3E96C741561746B4E0EEA5AE29DB124C2F7249|speE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37500 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTGTCATCTCCCTTTCG, downstream forward: _UP4_TAATGAAGGTATGGCGCAGG
  • References

  • 9723923,26735940