SubtiBank SubtiBank
yvdC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yvdC

unknown
locus
BSU_34650
pI
4.71
mw
12.20 kDa
protein length
106 aa Sequence Blast
gene length
321 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,559,632 3,559,952

    Expression and Regulation

    Operons

    genes
    [gene|4F237C02A306DF6A0D54E6DF4E558C8157F9B948|yvdC]
    description
    [Pubmed|22383849]

    additional information

  • Putative NrdR-box located between [protein|search|YvdC] and [protein|search|YvdD], suggesting transcriptional regulation by NrdR ([protein|search|YtcG]) [Pubmed|15949864]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B630 (yvdC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1629 NBRP B. subtilis, Japan]
  • BKE34650 ([gene|4F237C02A306DF6A0D54E6DF4E558C8157F9B948|yvdC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACCTCATCACTCCTGCAT, downstream forward: _UP4_TAAAAAAGCGGCCGCGATGG
  • BKK34650 ([gene|4F237C02A306DF6A0D54E6DF4E558C8157F9B948|yvdC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACCTCATCACTCCTGCAT, downstream forward: _UP4_TAAAAAAGCGGCCGCGATGG
  • References

  • 15949864,22383849