SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


12.20 kDa
protein length
106 aa Sequence Blast
gene length
321 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    3,559,632 3,559,952

    Expression and Regulation



    additional information

  • Putative NrdR-box located between [protein|search|YvdC] and [protein|search|YvdD], suggesting transcriptional regulation by NrdR ([protein|search|YtcG]) [Pubmed|15949864]
  • view in new tab

    Biological materials


  • MGNA-B630 (yvdC::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE34650 ([gene|4F237C02A306DF6A0D54E6DF4E558C8157F9B948|yvdC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACCTCATCACTCCTGCAT, downstream forward: _UP4_TAAAAAAGCGGCCGCGATGG
  • BKK34650 ([gene|4F237C02A306DF6A0D54E6DF4E558C8157F9B948|yvdC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACCTCATCACTCCTGCAT, downstream forward: _UP4_TAAAAAAGCGGCCGCGATGG
  • References

  • 15949864,22383849