SubtiBank SubtiBank
cssS
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

cssS

two-component sensor kinase, control of cellular responses to protein secretion stress
locus
BSU33020
pI
5.80
mw
51.92 kDa
protein length
451 aa Sequence Blast
gene length
1356 bp Sequence Blast
function
control of cellular responses to protein secretion stress
product
two-component sensor kinase
essential
no
synonyms
yvqB

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.2|Protein kinases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.2|Control of two-component response regulators] → [category|SW 3.4.2.2.1|Two-component sensor kinase]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.4|Heat shock proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    Coordinates
    3,386,398 3,387,753

    The protein

    Catalyzed reaction/ biological activity

  • autophosphorylation, phosphorylation of [protein|A40CD2C23A19860342F440284302EFFDAC09E88A|CssR]
  • Paralogous protein(s)

  • [protein|52BB660B0CAB36C74F1D47963235846B45AF78AB|YclK], [protein|96E4470EF4B558F4EC318FEBF58B779BA50DB7E2|YvrG], [protein|9E8A6AB3920BFBFDAAD1F2E4F333A32354ABB25B|YkoH], [protein|1582E81F7DA85F38D6732D341ABD0F052587F25A|KinE]
  • [SW|Domains]

  • two transmembrane segments, C-terminal histidine phosphotransferase domain
  • Modification

  • autophosphorylation on a His residue
  • Effectors of protein activity

  • the extracellular loop domain is required for signal perception [Pubmed|22307758]
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • localized primarily at the division septum but also found in a punctate pattern with lower intensity throughout the cell cylinder [Pubmed|22307758]
  • Expression and Regulation

    Operons

    genes
    [gene|A40CD2C23A19860342F440284302EFFDAC09E88A|cssR]-[gene|4EE48E4931F662E51586DB6D01E91C688329222D|cssS]
    description
    [Pubmed|11555295]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12270824], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|A40CD2C23A19860342F440284302EFFDAC09E88A|CssR]: activation, [Pubmed|12270824], in [regulon|A40CD2C23A19860342F440284302EFFDAC09E88A|CssR regulon]
  • regulation

  • expressed under conditions of secretion stress ([protein|search|CssR]) [Pubmed|12270824]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B216 (yvqB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1215 NBRP B. subtilis, Japan]
  • BKE33020 ([gene|4EE48E4931F662E51586DB6D01E91C688329222D|cssS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCATGATGACATCATCCT, downstream forward: _UP4_TAGACTGTAGATGTTTTGCA
  • BKK33020 ([gene|4EE48E4931F662E51586DB6D01E91C688329222D|cssS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCATGATGACATCATCCT, downstream forward: _UP4_TAGACTGTAGATGTTTTGCA
  • References

    Reviews

  • 27518094
  • Original Publications

  • 10094672,17600057,21630458,17088376,12270824,11555295,19820159,21602801,21624103,22307758