SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


polygalacturonan and rhamnogalacturonan [SW|ABC transporter] (transmembrane lipoprotein)
37.00 kDa
protein length
321 aa Sequence Blast
gene length
966 bp Sequence Blast
uptake of polygalacturonan and rhamnogalacturonan
polygalacturonan and rhamnogalacturonan [SW|ABC transporter] (transmembrane lipoprotein)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Importers] → [category|SW|Uptake of carbon sources]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of pectin]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,082,260 3,083,225

    The protein

    Protein family

  • [SW|Binding-protein-dependent transport system permease family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|AA19541BCCAE08B48BD23F4E8337EBA220E5C4EF|LplB]
  • [SW|Domains]

  • [SW|ABC transmembrane type-1 domain] (aa 1-144) (according to UniProt)
  • Structure

  • [PDB|4TQU] (from Sphingomonas sp., 43% identity) [pubmed|26235029]
  • [SW|Localization]

  • cell membrane [Pubmed|10092453]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A809 (yteP::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE30135 ([gene|4ED1DD17694A06CFDFF48943BAE8AEC2CCCB0401|yteP]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTCCTAGCCTCCTT, downstream forward: _UP4_TAGGAAAGGGATGGGATCAA
  • BKK30135 ([gene|4ED1DD17694A06CFDFF48943BAE8AEC2CCCB0401|yteP]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTCCTAGCCTCCTT, downstream forward: _UP4_TAGGAAAGGGATGGGATCAA
  • References

  • 10092453,17449691,29240795,26235029