SubtiBank SubtiBank
yteP
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yteP

polygalacturonan and rhamnogalacturonan [SW|ABC transporter] (transmembrane lipoprotein)
locus
BSU_30135
pI
9.17
mw
37.00 kDa
protein length
321 aa Sequence Blast
gene length
966 bp Sequence Blast
function
uptake of polygalacturonan and rhamnogalacturonan
product
polygalacturonan and rhamnogalacturonan [SW|ABC transporter] (transmembrane lipoprotein)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.1|Uptake of carbon sources]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.26|Utilization of pectin]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,082,260 3,083,225

    The protein

    Protein family

  • [SW|Binding-protein-dependent transport system permease family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|AA19541BCCAE08B48BD23F4E8337EBA220E5C4EF|LplB]
  • [SW|Domains]

  • [SW|ABC transmembrane type-1 domain] (aa 1-144) (according to UniProt)
  • Structure

  • [PDB|4TQU] (from Sphingomonas sp., 43% identity) [pubmed|26235029]
  • [SW|Localization]

  • cell membrane [Pubmed|10092453]
  • Expression and Regulation

    Operons

    genes
    [gene|4ED1DD17694A06CFDFF48943BAE8AEC2CCCB0401|yteP]-[gene|40787292458E5C6676F9F4F6F34C0D6BD5313DE1|yteR]-[gene|1482FD92CB6DC966263F08AD109769728FC708E4|yteS]-[gene|484D17480DFAD3667E0EBC6D38854A7546A8DB46|yteT]-[gene|103A912E971E5760DBA45CC0681D77CED61D1FED|yteU]-[gene|FCAE9513D764B7A9AAB9C59E6CE1D65C400D4B44|yteV]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A809 (yteP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/809 NBRP B. subtilis, Japan]
  • BKE30135 ([gene|4ED1DD17694A06CFDFF48943BAE8AEC2CCCB0401|yteP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30135 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTCCTAGCCTCCTT, downstream forward: _UP4_TAGGAAAGGGATGGGATCAA
  • BKK30135 ([gene|4ED1DD17694A06CFDFF48943BAE8AEC2CCCB0401|yteP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30135 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTCCTAGCCTCCTT, downstream forward: _UP4_TAGGAAAGGGATGGGATCAA
  • References

  • 10092453,17449691,29240795,26235029