SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


ATP-dependent metalloprotease
70.76 kDa
protein length
637 aa Sequence Blast
gene length
1914 bp Sequence Blast
cell division, sporulation initiation
ATP-dependent metalloprotease

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.8|Cell division] → [category|SW|Other genes]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW|Additional proteins involved in proteolysis]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW|Regulation]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.4|Heat shock proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    76,984 78,897

    Phenotypes of a mutant

  • defective in biofilm formation [Pubmed|22882210]
  • strongly reduced sporulation frequency [Pubmed|22142536], [Pubmed|26735940]
  • The protein

    Catalyzed reaction/ biological activity

  • degrades [protein|A574974B6F4FF46DC69E03AE021651C67089866F|Spo0E] and [protein|86BEE9B4DEA83B3B8EFC52EFDDC1F62314FC4291|Spo0M], resulting in reduced sporulation frequency in a ''ftsH'' mutant [Pubmed|22142536]
  • [protein|4E7B9426CED372AA8A321A147116A3A589FBF20C|FtsH] is involved in the degradation of [protein|B317D7E51824DD70EF84E4D5D7290D601BF4FAB6|EzrA] [Pubmed|24222488]
  • degrades [protein|7C8DFE00A2B2B30CC8BEB35055D92CC2E4128F3A|SpoIIE] [Pubmed|26465112]
  • Protein family

  • central section: [SW|AAA ATPase family] (according to UniProt)
  • C-terminal section: Peptidase M41 family (single member, according to UniProt)
  • Paralogous protein(s)

  • [protein|E278CCD5CFD618A0D4ACB92E1E06DCC1B4570ED0|YjoB]
  • Effectors of protein activity

  • protease activity is controlled by the interaction with the flottilins [protein|11A55829B4C3E8EA434A600FF7B4102F8E5A7DCE|FloA] and [protein|61893B4EB53FBBB9AD8BEEEFFCEFD0FC64544D6F|FloT] [Pubmed|24222488]
  • Structure

  • [PDB|1LV7] (from ''E. coli'', 64% identity) [Pubmed|12176385]
  • [SW|Localization]

  • cell membrane [Pubmed|18763711]
  • preferentially at the division septum [Pubmed|22882210]
  • forms some foci in the membrane [Pubmed|22882210]
  • Expression and Regulation



    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7608085], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|473F93EA5ADB78CD23C9C054B5D6B739078DDEEB|TilS]: activation, with [protein|B7BFC170EEC88DEC6CF932F80805D3F2C0BD3738|HprT] [Pubmed|24001521], in [regulon|473F93EA5ADB78CD23C9C054B5D6B739078DDEEB|TilS regulon]
  • [protein|B7BFC170EEC88DEC6CF932F80805D3F2C0BD3738|HprT]: activation, with [protein|473F93EA5ADB78CD23C9C054B5D6B739078DDEEB|TilS] [Pubmed|24001521], in [regulon|B7BFC170EEC88DEC6CF932F80805D3F2C0BD3738|HprT regulon]
  • regulation

  • induced by heat shock (class III)
  • additional information

  • the mRNA is very stable (half-life > 15 min) [ PubMed]
  • view in new tab


    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|16497325], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulation

  • expressed early during sporulation in the forespore ([protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]) [Pubmed|16497325]
  • view in new tab



  • induced by heat shock (class III)
  • additional information

  • the mRNA is very stable (half-life > 15 min) [ PubMed]
  • view in new tab

    Biological materials


  • GP2640 ([gene|4E7B9426CED372AA8A321A147116A3A589FBF20C|ftsH]::''aphA3''), available in [SW|Jörg Stülke]'s lab
  • MGNA-A084 (ftsH::erm), available at the [ NBRP B. subtilis, Japan]
  • 1A1061 ( ''ftsH''::''cat''), [Pubmed|9076729], available at [ BGSC]
  • 1A1060 ( ''ftsH''::''erm''), [Pubmed|10851010], available at [ BGSC]
  • BKE00690 ([gene|4E7B9426CED372AA8A321A147116A3A589FBF20C|ftsH]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCTTACCTCCTCCCAC, downstream forward: _UP4_TAATTCGCTTTCTTTCTAAA
  • BKK00690 ([gene|4E7B9426CED372AA8A321A147116A3A589FBF20C|ftsH]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCTTACCTCCTCCCAC, downstream forward: _UP4_TAATTCGCTTTCTTTCTAAA
  • References


  • 23479438,26639779,28748186
  • Original publications

  • 10913836,12533473,9076729,10851010,9084181,15386101,10077851,19332814,12884008,7608085,9352926,19332814,18763711,12176385,18179421,24001521,22882210,22142536,24222488,26297017,26465112,26735940,31930742