SubtiBank SubtiBank
melC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

melC

[SW|ABC transporter] for melibiose and raffinose (permease)
locus
BSU30290
pI
9.85
mw
30.22 kDa
protein length
276 aa Sequence Blast
gene length
831 bp Sequence Blast
function
uptake of melibiose and raffinose
product
sugar [SW|ABC transporter]
essential
no
synonyms
amyC

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.1|Uptake of carbon sources]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.21|Utilization of melibiose]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,100,031 3,100,861

    The protein

    Protein family

  • [SW|Binding-protein-dependent transport system permease family] (according to UniProt)
  • Structure

  • [PDB|4TQU] (from Sphingomonas sp., 26% identity) [pubmed|26235029]
  • [SW|Localization]

  • cell membrane [Pubmed|10092453]
  • Expression and Regulation

    Operons

    genes
    [gene|58276E6FEF9388BBC7FB79BB5A3A1EF3C3DA5BD5|melR]-[gene|C3D7C64AD0E58BF326257E23136466A237138B50|melE]-[gene|05BFEA711D82395A55B505E5A38286BE2F570350|melD]-[gene|4E766839240C8F7D56D87DF9E7B99350A83B5FF7|melC]-[gene|CDE9EF9CFB799794D525F12DEC8C4190C6298575|melA]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|22900538,31138628], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|22900538], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|58276E6FEF9388BBC7FB79BB5A3A1EF3C3DA5BD5|MelR]: repression, [pubmed|31138628], in [regulon|58276E6FEF9388BBC7FB79BB5A3A1EF3C3DA5BD5|MelR regulon]
  • regulation

  • induced by melibiose or raffinose ([protein|58276E6FEF9388BBC7FB79BB5A3A1EF3C3DA5BD5|MelR]) [pubmed|31138628]
  • repressed by glucose ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]) [Pubmed|22900538,31138628]
  • there is an additional RNA "upshift" signal in front of the [gene|C3D7C64AD0E58BF326257E23136466A237138B50|melE] gene suggestive of a [gene|C3D7C64AD0E58BF326257E23136466A237138B50|melE]-[gene|05BFEA711D82395A55B505E5A38286BE2F570350|melD]-[gene|4E766839240C8F7D56D87DF9E7B99350A83B5FF7|melC]-[gene|CDE9EF9CFB799794D525F12DEC8C4190C6298575|melA] mRNA [Pubmed|22383849]. However, there is no promoter in front of [gene|C3D7C64AD0E58BF326257E23136466A237138B50|melE], suggesting that this mRNA may be the product of mRNA processing [pubmed|31138628]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A798 (amyC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/798 NBRP B. subtilis, Japan]
  • BKE30290 ([gene|4E766839240C8F7D56D87DF9E7B99350A83B5FF7|melC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30290 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTTTTTGTACGGGCGG, downstream forward: _UP4_GGTTAACATTAAAGGGGGAA
  • BKK30290 ([gene|4E766839240C8F7D56D87DF9E7B99350A83B5FF7|melC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30290 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTTTTTGTACGGGCGG, downstream forward: _UP4_GGTTAACATTAAAGGGGGAA
  • References

  • 10092453,22383849,22900538,26235029,31138628