SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


23.19 kDa
protein length
208 aa Sequence Blast
gene length
627 bp Sequence Blast
control of [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW] activity

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW|Control of sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    195,426 196,052

    The protein

    Protein family

  • zinc-associated anti-sigma factor (ZAS) superfamily (with [protein|B454D14B33E2C11F0BB0A1D1BB743FA64981A966|YlaD], according to UniProt)
  • anti-sigma-W factor family (single member, according to UniProt)
  • [SW|Domains]

  • The cytoplasmic domain is able to inactivate SigW and the extracellular and transmembrane domains are crucial for sensing and transducing the signal that triggers SigW activation (PubMed:15130127). The N-terminus binds the zinc ion and is followed by a long helix (about residues 40-80) that fits into a hydrophobic surface groove on SigW, probably blocking its ability to interact with the -10 and -35 promoter elements (PubMed:28319136).
  • Effectors of protein activity

  • degraded by [protein|CB50289535EA537F63BADD459BD11AA7759A6658|RasP] and [protein|EE3B6B52EA19958E2E46A1545747F5209A6AA036|PrsW] under conditions of alkali shock or in the presence of antimicrobial peptides, respectively. This results in the release of [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]
  • Structure

  • [PDB|5WUQ] (the cytoplasmic domain in complex with [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]) [pubmed|28319136]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|12207695], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|12076816], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • induced under conditions of alkali shock or in the presence of the toxin [protein|search|SdpC] ([protein|search|SigW]) [Pubmed|12207695]
  • additional information

  • the mRNA is very stable (half-life > 15 min) [ PubMed]
  • view in new tab

    Biological materials


  • MGNA-B953 (ybbM::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE01740 ([gene|4E720917045032E8B45CB8AF6E5C13AE0E48EE33|rsiW]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGGACAGCTCATTTCATCAC, downstream forward: _UP4_TAAAGCGCGTTAGCCGCTTT
  • BKK01740 ([gene|4E720917045032E8B45CB8AF6E5C13AE0E48EE33|rsiW]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGGACAGCTCATTTCATCAC, downstream forward: _UP4_TAAAGCGCGTTAGCCGCTTT
  • labs

  • [SW|Thomas Wiegert], University of Bayreuth, Germany [ Homepage]
  • References


  • 20836086,22381678,29343670
  • Original Publications

  • 17020587,14993308,16816000,18599827,12207695,16899079,15130127,12884008,12076816,19889088,14993308,28319136,28674070