SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


two-component response regulator, regulation of the glsA-glnT operon
35.56 kDa
protein length
314 aa Sequence Blast
gene length
945 bp Sequence Blast
regulation of the glsA-glnT operon
two-component response regulator

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of glutamate/ glutamine/ ammonium assimilation]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW|Utilization of glutamine/ glutamate]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Two-component system response regulators]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.2|Phosphorylation on an Asp residue]
  • Gene

    266,719 267,663

    The protein


  • [SW|Response regulatory domain] (aa 2–118) (according to UniProt)
  • Modification

  • phosphorylated by [protein|C18B886D06879C64B64606371E85A7D4D22DCFAC|GlnK] on an Asp residue
  • Effectors of protein activity

  • phosphorylation likely affects DNA-binding activity
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-C026 (ycbB::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE02450 ([gene|4E6EA2EABBDAA427E8F9EE1AE1800AF8657CF18B|glnL]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGCTTTTGGTTCACCCT, downstream forward: _UP4_TAAACCAAACAGCCGGCTGA
  • BKK02450 ([gene|4E6EA2EABBDAA427E8F9EE1AE1800AF8657CF18B|glnL]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGCTTTTGGTTCACCCT, downstream forward: _UP4_TAAACCAAACAGCCGGCTGA
  • References

  • 10094672,15995196