SubtiBank SubtiBank
ysdB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ysdB

control of [protein|search|SigW ]activity, survival of heat stress
locus
BSU_28830
pI
9.41
mw
15.43 kDa
protein length
130 aa Sequence Blast
gene length
393 bp Sequence Blast
function
survival of heat stress
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW 3.4.1.2|Control of sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,951,490 2,951,882

    Phenotypes of a mutant

  • constitutive [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW] activity [Pubmed|10960106]
  • The protein

    [SW|Domains]

  • contains a transmembrane domain
  • [SW|Localization]

  • integral membrane protein [Pubmed|16816000]
  • Expression and Regulation

    Operons

    genes
    [gene|4E3ED9AB8EB465B9D4DDF58F69D277F35CC2A78C|ysdB]
    description
    [Pubmed|9987136]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|9987136], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|15805528], [protein|search|SigW] [Pubmed|9987136]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A984 (ysdB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/984 NBRP B. subtilis, Japan]
  • BKE28830 ([gene|4E3ED9AB8EB465B9D4DDF58F69D277F35CC2A78C|ysdB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTGTGAAGGCACCTCC, downstream forward: _UP4_GAGCGTTAAACGCTTTTCTG
  • BKK28830 ([gene|4E3ED9AB8EB465B9D4DDF58F69D277F35CC2A78C|ysdB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTGTGAAGGCACCTCC, downstream forward: _UP4_GAGCGTTAAACGCTTTTCTG
  • References

    Reviews

  • Additional reviews:''' [Pubmed|22381678]
  • Original Publications

  • 10960106,9987136,15805528,16816000