SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


control of [protein|search|SigW ]activity, survival of heat stress
15.43 kDa
protein length
130 aa Sequence Blast
gene length
393 bp Sequence Blast
survival of heat stress

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW|Control of sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,951,490 2,951,882

    Phenotypes of a mutant

  • constitutive [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW] activity [Pubmed|10960106]
  • The protein


  • contains a transmembrane domain
  • [SW|Localization]

  • integral membrane protein [Pubmed|16816000]
  • Expression and Regulation



    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|9987136], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|15805528], [protein|search|SigW] [Pubmed|9987136]
  • view in new tab

    Biological materials


  • MGNA-A984 (ysdB::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE28830 ([gene|4E3ED9AB8EB465B9D4DDF58F69D277F35CC2A78C|ysdB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTGTGAAGGCACCTCC, downstream forward: _UP4_GAGCGTTAAACGCTTTTCTG
  • BKK28830 ([gene|4E3ED9AB8EB465B9D4DDF58F69D277F35CC2A78C|ysdB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTGTGAAGGCACCTCC, downstream forward: _UP4_GAGCGTTAAACGCTTTTCTG
  • References


  • Additional reviews:''' [Pubmed|22381678]
  • Original Publications

  • 10960106,9987136,15805528,16816000