SubtiBank SubtiBank
kapD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

kapD

inhibitor of the KinA pathway to sporulation
locus
BSU_31470
pI
6.38
mw
23.68 kDa
protein length
205 aa Sequence Blast
gene length
618 bp Sequence Blast
function
regulation of sporulation initiation
product
inhibitor of the KinA pathway to sporulation
essential
no
synonyms
yugB

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay]
  • Gene

    Coordinates
    3,231,812 3,232,429

    The protein

    [SW|Domains]

  • [SW|Exonuclease domain] (aa 6-173) (according to UniProt)
  • [SW|Localization]

  • Cytoplasm (Homogeneous) [Pubmed|16479537]
  • Biological materials

    Mutant

  • MGNA-A611 (kapD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/611 NBRP B. subtilis, Japan]
  • BKE31470 ([gene|4E384490E7D2761BC8779483C4950D6D14323D1C|kapD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31470 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCTTTTACACCTGCCTTT, downstream forward: _UP4_TAAAAAACCCAATCTTTTGT
  • BKK31470 ([gene|4E384490E7D2761BC8779483C4950D6D14323D1C|kapD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31470 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCTTTTACACCTGCCTTT, downstream forward: _UP4_TAAAAAACCCAATCTTTTGT
  • References

  • 16479537