SubtiBank SubtiBank
yhdN
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yhdN

general stress protein, broad specificity aldo-keto reductase that converts MG to acetol
locus
BSU09530
pI
4.77
mw
37.16 kDa
protein length
331 aa Sequence Blast
gene length
996 bp Sequence Blast
function
detoxification of methylglyoxal
product
aldo/keto reductase, specific for NADP
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.2|Biosynthesis of lipids] → [category|SW 2.4.2.1|Biosynthesis of fatty acids]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    1,030,265 1,031,260

    Phenotypes of a mutant

  • increased sensitivity to methylglyoxal [Pubmed|24330391]
  • The protein

    Catalyzed reaction/ biological activity

  • methylglyoxal ---> acetol [Pubmed|24330391]
  • Protein family

  • [SW|Aldo/keto reductase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|B73D729097C00BE6F3C7FF1708738783EE93C6FB|YccK], [protein|D0A2506FDCEA41D2A8910AC2837B46E0B311D63B|YcsN], [protein|F1AFFACD36C75702B0BB8F0B4241A9688FB6253C|IolS]
  • [SW|Cofactors]

  • NADPH [Pubmed|24330391]
  • Structure

  • [PDB|1PZ1] [Pubmed|15019785]
  • Expression and Regulation

    Operons

    genes
    [gene|4DF9B105ABA64AFD5106EE75FCC9EFAB52BEFC83|yhdN]-[gene|FC05D5FC95CEDC4B4A04040C86170D185528B9FF|plsC]
    description
    [Pubmed|10220166]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|10220166,15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulatory mechanism

  • [protein|FCDE900167AE36377979E0CF7BC33C7F351B95D3|FapR]: repression, [Pubmed|12737802], in [regulon|FCDE900167AE36377979E0CF7BC33C7F351B95D3|FapR regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|10220166,15805528]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A695 (yhdN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/695 NBRP B. subtilis, Japan]
  • BKE09530 ([gene|4DF9B105ABA64AFD5106EE75FCC9EFAB52BEFC83|yhdN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTGCCACTCCTTCACT, downstream forward: _UP4_TAACAAAAGCTGAGGGCGAA
  • BKK09530 ([gene|4DF9B105ABA64AFD5106EE75FCC9EFAB52BEFC83|yhdN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTGCCACTCCTTCACT, downstream forward: _UP4_TAACAAAAGCTGAGGGCGAA
  • References

  • 10220166,15019785,24330391,12737802,15805528