The second international online conference
#Subtillery2021 will be held 14th - 18th June - save the date, for more information see the
conference website!
The 21st
International Conference on Bacilli has been postponed to 2022 and will take place in Prague.
glucosamine-specific permease of the [SW|phosphotransferase systems|phosphotransferase system], EIICBA of the [category|SW 1.2.2|PTS]
function
glucosamine uptake and phosphorylation
product
glucosamine-specific [category|SW 1.2.2|PTS], EIICBA
Genomic Context
categories
[category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW 1.1.3.3|Utilization of cell wall components][category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.2|Phosphotransferase system] → [category|SW 1.2.2.2|Sugar specific PTS proteins][category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.17|Utilization of amino sugars][category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW 2.3.3.3|Utilization of amino sugars][category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins][category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.3|Phosphorylation on a Cys residue][category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]Gene
Coordinates
254,907 256,802
Phenotypes of a mutant
delayed growth with glucosamine as the single carbon source [Pubmed|10627040]The protein
Catalyzed reaction/ biological activity
protein EIIA Npi-phospho-L-histidine + protein EIIB --> protein EIIA + protein EIIB Npi-phospho-L-histidine/cysteine (according to UniProt)Protein family
[category|SW 1.2.2|PTS] permease, glucose family [Pubmed|10627040]Paralogous protein(s)
[protein|7D5A8084FDDA962CCF028FC3735E68C4F2E77084|NagP] [SW|Domains]
[SW|PTS EIIA domain] type-1 (aa 515-619) (according to UniProt)[SW|PTS EIIB domain] type-1 (aa 397-478) (according to UniProt)[SW|PTS EIIC domain] type-1 (aa 1-382) (according to UniProt)Structure
[PDB|6BVG] (EIIC domain from B. cereus, corresponds to aa 5 ... 380), 32.5% identity [pubmed|29784777][PDB|3BP3] (EIIB domain from E. coli, corresponds to aa 403 ... 467), 56.9% identity [pubmed|18319344][PDB|1AX3] (EIIA domain of [protein|B5E7EB475434E96786C577AE709A21BD702733D8|PtsG], corresponds to aa 489 ... 622), 55.6% identity [pubmed|9593197][SW|Localization]
membrane [Pubmed|18763711]Expression and Regulation
Operons
genes
[gene|8BBC9AFF4CD56A3A66E270A2BBA193D095EE01D1|gamA]-[gene|4DF1740D4DFB9FD25E77C14D28AEA01707776099|gamP]
description
[Pubmed|23667565]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|23667565], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]regulatory mechanism
[protein|FB074E8CFCA1C0198457170A7AFD85C875B34DF2|GamR]: repression, [Pubmed|24673833,23667565], in [regulon|FB074E8CFCA1C0198457170A7AFD85C875B34DF2|GamR regulon]regulation
induced by glucosamine ([protein|search|GamR]) [Pubmed|24673833,23667565]view in new tabBiological materials
Mutant
MGNA-B937 (ybfS::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1936 NBRP B. subtilis, Japan]QB6098 (aphA3), available in [SW|Jörg Stülke]'s labBKE02350 ([gene|4DF1740D4DFB9FD25E77C14D28AEA01707776099|gamP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02350 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACAGTCTCCTTTTATT, downstream forward: _UP4_TAAAAAAGTCCCCCCTGCTGBKK02350 ([gene|4DF1740D4DFB9FD25E77C14D28AEA01707776099|gamP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02350 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACAGTCTCCTTTTATT, downstream forward: _UP4_TAAAAAAGTCCCCCCTGCTGReferences
10627040,18763711,24673833,23667565,30038046,29784777,18319344,9593197