SubtiBank SubtiBank
gamP
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.

gamP

glucosamine-specific phosphotransferase system, EIICBA of the PTS
locus
BSU02350
pI
5.47
mw
67.97 kDa
protein length
631 aa Sequence Blast
gene length
1893 bp Sequence Blast
function
glucosamine uptake and phosphorylation
product
glucosamine-specific phosphotransferase system, EIICBA
essential
no
ec
2.7.1.69
synonyms
ybfS, yzfA

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW 1.1.3.3|Utilization of cell wall components]
  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.2|Phosphotransferase system] → [category|SW 1.2.2.2|Sugar specific PTS proteins]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.17|Utilization of amino sugars]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW 2.3.3.3|Utilization of amino sugars]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.3|Phosphorylation on a Cys residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    Coordinates
    254,907 → 256,802

    Phenotypes of a mutant

  • delayed growth with glucosamine as the single carbon source [Pubmed|10627040]
  • The protein

    Catalyzed reaction/ biological activity

  • protein EIIA N(pi)-phospho-L-histidine + protein EIIB = protein EIIA + protein EIIB N(pi)-phospho-L-histidine/cysteine (according to Swiss-Prot)
  • Protein family

  • [protein|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|PtsI] permease, glucose permease (Glc) family [Pubmed|10627040]
  • Paralogous protein(s)

  • [protein|7D5A8084FDDA962CCF028FC3735E68C4F2E77084|NagP]
  • [SW|Localization]

  • membrane [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|8BBC9AFF4CD56A3A66E270A2BBA193D095EE01D1|gamA]-[gene|4DF1740D4DFB9FD25E77C14D28AEA01707776099|gamP]
    description
    [Pubmed|23667565]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|23667565], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|FB074E8CFCA1C0198457170A7AFD85C875B34DF2|GamR]: repression, [Pubmed|24673833,23667565], in [regulon|FB074E8CFCA1C0198457170A7AFD85C875B34DF2|GamR regulon]
  • regulation

  • induced by glucosamine ([protein|search|GamR]) [Pubmed|24673833,23667565]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B937 (ybfS::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1936 NBRP B. subtilis, Japan]
  • QB6098 (aphA3), available in [SW|Stülke] lab
  • BKE02350 (Δ[gene|4DF1740D4DFB9FD25E77C14D28AEA01707776099|gamP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02350 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACAGTCTCCTTTTATT, downstream forward: _UP4_TAAAAAAGTCCCCCCTGCTG
  • BKK02350 (Δ[gene|4DF1740D4DFB9FD25E77C14D28AEA01707776099|gamP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02350 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACAGTCTCCTTTTATT, downstream forward: _UP4_TAAAAAAGTCCCCCCTGCTG
  • References

  • 10627040,18763711,24673833,23667565