SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


glucosamine-specific permease of the [SW|phosphotransferase systems|phosphotransferase system], EIICBA of the [category|SW 1.2.2|PTS]
67.97 kDa
protein length
631 aa Sequence Blast
gene length
1896 bp Sequence Blast
glucosamine uptake and phosphorylation
glucosamine-specific [category|SW 1.2.2|PTS], EIICBA

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW|Utilization of cell wall components]
  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.2|Phosphotransferase system] → [category|SW|Sugar specific PTS proteins]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of amino sugars]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW|Utilization of amino sugars]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.3|Phosphorylation on a Cys residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    254,907 256,802

    Phenotypes of a mutant

  • delayed growth with glucosamine as the single carbon source [Pubmed|10627040]
  • The protein

    Catalyzed reaction/ biological activity

  • protein EIIA Npi-phospho-L-histidine + protein EIIB --> protein EIIA + protein EIIB Npi-phospho-L-histidine/cysteine (according to UniProt)
  • Protein family

  • [category|SW 1.2.2|PTS] permease, glucose family [Pubmed|10627040]
  • Paralogous protein(s)

  • [protein|7D5A8084FDDA962CCF028FC3735E68C4F2E77084|NagP]
  • [SW|Domains]

  • [SW|PTS EIIA domain] type-1 (aa 515-619) (according to UniProt)
  • [SW|PTS EIIB domain] type-1 (aa 397-478) (according to UniProt)
  • [SW|PTS EIIC domain] type-1 (aa 1-382) (according to UniProt)
  • Structure

  • [PDB|6BVG] (EIIC domain from B. cereus, corresponds to aa 5 ... 380), 32.5% identity [pubmed|29784777]
  • [PDB|3BP3] (EIIB domain from E. coli, corresponds to aa 403 ... 467), 56.9% identity [pubmed|18319344]
  • [PDB|1AX3] (EIIA domain of [protein|B5E7EB475434E96786C577AE709A21BD702733D8|PtsG], corresponds to aa 489 ... 622), 55.6% identity [pubmed|9593197]
  • [SW|Localization]

  • membrane [Pubmed|18763711]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|23667565], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|FB074E8CFCA1C0198457170A7AFD85C875B34DF2|GamR]: repression, [Pubmed|24673833,23667565], in [regulon|FB074E8CFCA1C0198457170A7AFD85C875B34DF2|GamR regulon]
  • regulation

  • induced by glucosamine ([protein|search|GamR]) [Pubmed|24673833,23667565]
  • view in new tab

    Biological materials


  • MGNA-B937 (ybfS::erm), available at the [ NBRP B. subtilis, Japan]
  • QB6098 (aphA3), available in [SW|Jörg Stülke]'s lab
  • BKE02350 ([gene|4DF1740D4DFB9FD25E77C14D28AEA01707776099|gamP]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACAGTCTCCTTTTATT, downstream forward: _UP4_TAAAAAAGTCCCCCCTGCTG
  • BKK02350 ([gene|4DF1740D4DFB9FD25E77C14D28AEA01707776099|gamP]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACAGTCTCCTTTTATT, downstream forward: _UP4_TAAAAAAGTCCCCCCTGCTG
  • References

  • 10627040,18763711,24673833,23667565,30038046,29784777,18319344,9593197