SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


DNA 3-5 helicase IV, stimulates [SW|transcription] in an ATP-dependent manner by enhancing transcriptional cycling and elongation
89.74 kDa
protein length
774 aa Sequence Blast
gene length
2325 bp Sequence Blast
[SW|transcription], [SW|DNA repair/ recombination]
DNA 3-5 helicase IV

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW|Other proteins]
  • Gene

    3,434,327 3,436,651

    The protein

    Catalyzed reaction/ biological activity

  • ATP + H2O --> ADP + H+ + phosphate (according to UniProt)
  • Protein family

  • [SW|helicase family] (according to UniProt)
  • [SW|Domains]

  • [SW|UvrD-like helicase ATP-binding domain] (aa 212-610) (according to UniProt)
  • Structure

  • [PDB|3DMN] (C-terminal domain of the protein from ''Lactobacillus plantarum'', 39% identity)
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • additional information

  • [protein|4DE90422754DA1FD9EFE58766EACB99CE6171207|HelD] may interact with [SW|RNA polymerase] [pubmed|21710567]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A456 (yvgS::erm), available at the [ NBRP B. subtilis, Japan]
  • 1A899 ( ''helD''::''erm''), available at [ BGSC]
  • BKE33450 (''[gene|4DE90422754DA1FD9EFE58766EACB99CE6171207|helD]''::''erm'', available in the BGSC, in [SW|Fabian Commichau]'s, and in [SW|Jörg Stülke]'s lab) [pubmed|28189581]
  • BKE33450 ([gene|4DE90422754DA1FD9EFE58766EACB99CE6171207|helD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAACGGCACCTCCAGAA, downstream forward: _UP4_TGAAGAGAAGGGAGTCCTTC
  • BKK33450 ([gene|4DE90422754DA1FD9EFE58766EACB99CE6171207|helD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAACGGCACCTCCAGAA, downstream forward: _UP4_TGAAGAGAAGGGAGTCCTTC
  • References

  • 24520113,21710567,30186259,30972737