SubtiBank SubtiBank
yycD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yycD

general stress protein, survival of ethanol stress
locus
BSU_40450
pI
4.78
mw
7.33 kDa
protein length
gene length
201 bp Sequence Blast
function
survival of ethanol stress
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • Gene

    Coordinates
    4,159,005 4,159,205

    The protein

    Structure

  • [PDB|2ZF3] (from Chromobacterium violaceum, 31% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|4DE499A579610BD576772AED84B1F4256A2418D6|yycD]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B830 (yycD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1829 NBRP B. subtilis, Japan]
  • BKE40450 ([gene|4DE499A579610BD576772AED84B1F4256A2418D6|yycD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTCATTCCTCCCTTA, downstream forward: _UP4_TAATGAATGAAAGCCTTCGC
  • BKK40450 ([gene|4DE499A579610BD576772AED84B1F4256A2418D6|yycD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTCATTCCTCCCTTA, downstream forward: _UP4_TAATGAATGAAAGCCTTCGC
  • References

  • 12823818,15805528,27766092