SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


chaperone for the export of [protein|C6012DEA301DF5B2DDD7E673A736BD3E5163F209|FliD]
13.40 kDa
protein length
113 aa Sequence Blast
gene length
342 bp Sequence Blast
movement and chemotaxis
chaperone for [protein|C6012DEA301DF5B2DDD7E673A736BD3E5163F209|FliD] export

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW|Flagellar proteins]
  • Gene

    3,632,150 3,632,491

    Phenotypes of a mutant

  • the mutation suppresses the mucoid phenotype of ''[gene|86C729C7D5ABEE519ADC4A893940600BBB655EF1|motA]'' or ''[gene|FE56753D061344B0F10A6523F49C5C7356AA40B6|motB]'' mutants [Pubmed|24296669]
  • The protein

    Catalyzed reaction/ biological activity

  • prevents premature assembly of [protein|C6012DEA301DF5B2DDD7E673A736BD3E5163F209|FliD] [Pubmed|26490009]
  • Protein family

  • Bacillales fliT family (single member, according to UniProt)
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|26577401], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • view in new tab


    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|8195064], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • view in new tab

    Biological materials


  • BKE35320 ([gene|4DE156D248FAF7DE3ED9AC35F006B5319A3C1BDA|fliT]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGTGTATAGTTGATCTATAT, downstream forward: _UP4_GACAAGCGTAAATAGGTGAG
  • BKK35320 ([gene|4DE156D248FAF7DE3ED9AC35F006B5319A3C1BDA|fliT]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGTGTATAGTTGATCTATAT, downstream forward: _UP4_GACAAGCGTAAATAGGTGAG
  • References


  • 26490009
  • Original publications

  • 8195064,20534509,24296669