SubtiBank SubtiBank
fliT
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

fliT

chaperone for the export of [protein|C6012DEA301DF5B2DDD7E673A736BD3E5163F209|FliD]
locus
BSU_35320
pI
5.62
mw
13.40 kDa
protein length
113 aa Sequence Blast
gene length
342 bp Sequence Blast
function
movement and chemotaxis
product
chaperone for [protein|C6012DEA301DF5B2DDD7E673A736BD3E5163F209|FliD] export
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW 4.1.1.2|Flagellar proteins]
  • Gene

    Coordinates
    3,632,150 3,632,491

    Phenotypes of a mutant

  • the mutation suppresses the mucoid phenotype of ''[gene|86C729C7D5ABEE519ADC4A893940600BBB655EF1|motA]'' or ''[gene|FE56753D061344B0F10A6523F49C5C7356AA40B6|motB]'' mutants [Pubmed|24296669]
  • The protein

    Catalyzed reaction/ biological activity

  • prevents premature assembly of [protein|C6012DEA301DF5B2DDD7E673A736BD3E5163F209|FliD] [Pubmed|26490009]
  • Protein family

  • Bacillales fliT family (single member, according to UniProt)
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|4DBF4635B5C5A7541E8F97440D139DAA02547B99|yvyC]-[gene|C6012DEA301DF5B2DDD7E673A736BD3E5163F209|fliD]-[gene|4882FAD988FEDD0E72E4CAFB10C8DE61DDAC23B0|fliS]-[gene|4DE156D248FAF7DE3ED9AC35F006B5319A3C1BDA|fliT]-[gene|A6E7212D159F076F5D26F9C02F340B40C3667623|smiA]-[gene|06FEA5F205B40DD5CF8D9F1328E940D4543F4741|S1350]-[gene|37B8B671B84266A7D65B90A9077A0DFF458D1851|hpf]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|26577401], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • view in new tab

    genes
    [gene|4DBF4635B5C5A7541E8F97440D139DAA02547B99|yvyC]-[gene|C6012DEA301DF5B2DDD7E673A736BD3E5163F209|fliD]-[gene|4882FAD988FEDD0E72E4CAFB10C8DE61DDAC23B0|fliS]-[gene|4DE156D248FAF7DE3ED9AC35F006B5319A3C1BDA|fliT]
    description
    [Pubmed|8195064]

    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|8195064], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • view in new tab

    Biological materials

    Mutant

  • BKE35320 ([gene|4DE156D248FAF7DE3ED9AC35F006B5319A3C1BDA|fliT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGTGTATAGTTGATCTATAT, downstream forward: _UP4_GACAAGCGTAAATAGGTGAG
  • BKK35320 ([gene|4DE156D248FAF7DE3ED9AC35F006B5319A3C1BDA|fliT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGTGTATAGTTGATCTATAT, downstream forward: _UP4_GACAAGCGTAAATAGGTGAG
  • References

    Reviews

  • 26490009
  • Original publications

  • 8195064,20534509,24296669