SubtiBank SubtiBank
yvyC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yvyC

similar to flagellar protein
locus
BSU_35350
pI
4.70
mw
12.89 kDa
protein length
109 aa Sequence Blast
gene length
330 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
yviH

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW 4.1.1.3|Flagellar proteins/ based on similarity]
  • Gene

    Coordinates
    3,634,425 3,634,754

    The protein

    Structure

  • [PDB|2HC5] (NMR)
  • Expression and Regulation

    Operons

    genes
    [gene|4DBF4635B5C5A7541E8F97440D139DAA02547B99|yvyC]-[gene|C6012DEA301DF5B2DDD7E673A736BD3E5163F209|fliD]-[gene|4882FAD988FEDD0E72E4CAFB10C8DE61DDAC23B0|fliS]-[gene|4DE156D248FAF7DE3ED9AC35F006B5319A3C1BDA|fliT]-[gene|A6E7212D159F076F5D26F9C02F340B40C3667623|smiA]-[gene|06FEA5F205B40DD5CF8D9F1328E940D4543F4741|S1350]-[gene|37B8B671B84266A7D65B90A9077A0DFF458D1851|hpf]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|26577401], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • view in new tab

    genes
    [gene|4DBF4635B5C5A7541E8F97440D139DAA02547B99|yvyC]-[gene|C6012DEA301DF5B2DDD7E673A736BD3E5163F209|fliD]-[gene|4882FAD988FEDD0E72E4CAFB10C8DE61DDAC23B0|fliS]-[gene|4DE156D248FAF7DE3ED9AC35F006B5319A3C1BDA|fliT]
    description
    [Pubmed|8195064]

    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|8195064], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • view in new tab

    Biological materials

    Mutant

  • BKE35350 ([gene|4DBF4635B5C5A7541E8F97440D139DAA02547B99|yvyC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35350 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTGATCATCCCCTATGC, downstream forward: _UP4_AAGTAGAATAGGAGTGGTTT
  • BKK35350 ([gene|4DBF4635B5C5A7541E8F97440D139DAA02547B99|yvyC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35350 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTGATCATCCCCTATGC, downstream forward: _UP4_AAGTAGAATAGGAGTGGTTT
  • References

  • 8195064,19455708