SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to flagellar protein
12.89 kDa
protein length
109 aa Sequence Blast
gene length
330 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW|Flagellar proteins/ based on similarity]
  • Gene

    3,634,425 3,634,754

    The protein


  • [PDB|2HC5] (NMR)
  • Expression and Regulation



    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|26577401], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • view in new tab


    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|8195064], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • view in new tab

    Biological materials


  • BKE35350 ([gene|4DBF4635B5C5A7541E8F97440D139DAA02547B99|yvyC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTGATCATCCCCTATGC, downstream forward: _UP4_AAGTAGAATAGGAGTGGTTT
  • BKK35350 ([gene|4DBF4635B5C5A7541E8F97440D139DAA02547B99|yvyC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTGATCATCCCCTATGC, downstream forward: _UP4_AAGTAGAATAGGAGTGGTTT
  • References

  • 8195064,19455708