SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


dipicolinate synthase (subunit B)
21.72 kDa
protein length
200 aa Sequence Blast
gene length
603 bp Sequence Blast
dipicolic acid production
dipicolinate synthase (subunit B)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW|Biosynthesis of dipicolinate]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • Gene

    1,745,263 1,745,865

    The protein

    Catalyzed reaction/ biological activity

  • (S)-2,3-dihydrodipicolinate + NADP+ --> dipicolinate + H+ + NADPH (according to UniProt)
  • Structure

  • [PDB|3MCU] (from B. cereus, 72% identity)
  • Expression and Regulation



    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190,8098035], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|search|SigK]) [Pubmed|15699190,8098035]
  • view in new tab

    Biological materials


  • BKE16740 ([gene|4D93A13DB9DC55A49525BFF4FD589F4FF67D50E8|spoVFB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTTCCTTTTAATGACGACA, downstream forward: _UP4_TAAATTTACAGAAAATCTTT
  • BKK16740 ([gene|4D93A13DB9DC55A49525BFF4FD589F4FF67D50E8|spoVFB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTTCCTTTTAATGACGACA, downstream forward: _UP4_TAAATTTACAGAAAATCTTT
  • References

  • 8345520,8098035,15699190