SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


flagellar assembly protein, negative regulator of the FliI ATPase
23.64 kDa
protein length
208 aa Sequence Blast
gene length
627 bp Sequence Blast
movement and chemotaxis
flagellar assembly protein

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW|Flagellar proteins]
  • Gene

    1,695,254 1,695,880

    The protein

    Protein family

  • fliH family (single member, according to UniProt)
  • [SW|Localization]

  • cytoplasm, as part of the flagellum attached to the membrane [Pubmed|26490009]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9657996], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|9657996], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA]: activation, in [regulon|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: repression, in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    Biological materials


  • BKE16230 ([gene|4D8CF3BED8F94DE3F8FCDEB1FE55D5F1D17FE26F|fliH]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGCGCCTCCGGGTTCT, downstream forward: _UP4_GCGCTGGAAGCAGGTGCAGC
  • BKK16230 ([gene|4D8CF3BED8F94DE3F8FCDEB1FE55D5F1D17FE26F|fliH]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGCGCCTCCGGGTTCT, downstream forward: _UP4_GCGCTGGAAGCAGGTGCAGC
  • References


  • 24064315,18931786,26490009
  • Original publications

  • 14651647,17850253,9657996,8157612,15175317,24386445,10998179