SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


exonuclease SbcD homolog
43.25 kDa
protein length
391 aa Sequence Blast
gene length
1176 bp Sequence Blast
exonuclease SbcD homolog

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW|Other proteins]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • Gene

    1,143,577 1,144,752

    Phenotypes of a mutant

  • reduced resistance towards electron beams [pubmed|31948638]
  • The protein

    Protein family

  • sbcD family (single member, according to UniProt)
  • Structure

  • [PDB|4LTY] (from E. coli, corresponds to aa 1 - 314 of SbcD, 30% identity) [pubmed|24531464]
  • [SW|Localization]

  • Cytoplasm (Homogeneous) [Pubmed|16479537]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7746142], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • regulation

  • positive control by [protein|search|ComK] [Pubmed|7746142]
  • view in new tab

    Biological materials


  • GP894 (''sbcCD''::''kan''), available in [SW|Jörg Stülke]'s lab [pubmed|22178973]
  • BKE10640 ([gene|4D89BFFB1073407A7A1762AFD18B49F3414D6787|sbcD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATGCTTTCACCTCTCTT, downstream forward: _UP4_GGCGTTGAAGAGGAGGATGC
  • BKK10640 ([gene|4D89BFFB1073407A7A1762AFD18B49F3414D6787|sbcD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATGCTTTCACCTCTCTT, downstream forward: _UP4_GGCGTTGAAGAGGAGGATGC
  • References

  • 8493111,11948146,22383849,16479537,24531464,30277537,31948638