SubtiBank SubtiBank
sbcD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

sbcD

exonuclease SbcD homolog
locus
BSU_10640
pI
5.00
mw
43.25 kDa
protein length
391 aa Sequence Blast
gene length
1176 bp Sequence Blast
function
unknown
product
exonuclease SbcD homolog
essential
no
synonyms
yixA

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW 3.1.5.6|Other proteins]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • Gene

    Coordinates
    1,143,577 1,144,752

    The protein

    Protein family

  • sbcD family (single member, according to UniProt)
  • Structure

  • [PDB|4LTY] (from E. coli, corresponds to aa 1 - 314 of SbcD, 30% identity) [pubmed|24531464]
  • [SW|Localization]

  • Cytoplasm (Homogeneous) [Pubmed|16479537]
  • Expression and Regulation

    Operons

    genes
    [gene|55A1EF8A10CB398CCD3FDD06D9483FE0DCE31C64|addB]-[gene|49E8BFEC1CAB77DD91E0ED0791EBD480E4871239|addA]-[gene|4D89BFFB1073407A7A1762AFD18B49F3414D6787|sbcD]-[gene|ED825D5B3290BA8F9C92477B1FCC433ADB3C8449|sbcC]-[gene|74E2AB77354355549D14152D3566C9B953A4CB31|hlpB]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7746142], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • regulation

  • positive control by [protein|search|ComK] [Pubmed|7746142]
  • view in new tab

    Biological materials

    Mutant

  • GP894 (''sbcCD''::''kan''), available in [SW|Jörg Stülke]'s lab
  • BKE10640 ([gene|4D89BFFB1073407A7A1762AFD18B49F3414D6787|sbcD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10640 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATGCTTTCACCTCTCTT, downstream forward: _UP4_GGCGTTGAAGAGGAGGATGC
  • BKK10640 ([gene|4D89BFFB1073407A7A1762AFD18B49F3414D6787|sbcD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10640 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATGCTTTCACCTCTCTT, downstream forward: _UP4_GGCGTTGAAGAGGAGGATGC
  • References

  • 8493111,11948146,22383849,16479537,24531464,30277537