SubtiBank SubtiBank
hisC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

hisC

histidinol-phosphate aminotransferase / tyrosine and phenylalanine aminotransferase
locus
BSU22620
pI
5.01
mw
39.93 kDa
protein length
360 aa Sequence Blast
gene length
1083 bp Sequence Blast
function
biosynthesis of aromatic amino acids
product
histidinol-phosphate aminotransferase / tyrosine and phenylalanine aminotransferase
essential
no
ec
2.6.1.9
synonyms
aroJ

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.13|Biosynthesis/ acquisition of aromatic amino acids]
  • Gene

    Coordinates
    2,370,415 2,371,497

    The protein

    Catalyzed reaction/ biological activity

  • L-histidinol phosphate 2-oxoglutarate = 3-(imidazol-4-yl)-2-oxopropyl phosphate L-glutamate (according to Swiss-Prot)
  • Protein family

  • [SW|class-II pyridoxal-phosphate-dependent aminotransferase family] (according to UniProt)
  • [SW|Cofactors]

  • PLP (according to UniProt)
  • Structure

  • [PDB|3FFH] (from ''Listeria innocua'', 52% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|48C33A96F3B446440D4D9A86AA07AA3BA244063D|trpE]-[gene|4CD2A930753175B7F533EA6B91478577CE80A29C|trpD]-[gene|0467447B10EE7C1FDF86022AB6FBDBABFD32A9E5|trpC]-[gene|C6872585F9BD3717A4F49E96F7684C4A5AD1760D|trpF]-[gene|AEB1F4E28C5B2AFC7FCF65721D4D1A70D6FC38EE|trpB]-[gene|155FE26C148F7022948DD7539533AB6876571862|trpA]-[gene|4D7D62B4CDA350DCDC04E6934B5E23ECE4C57870|hisC]-[gene|DEB8358CE34F80560BE91F036659EF2C67A19623|tyrA]-[gene|CA00DFB480CBDC8AC31559958EF8E97E1E9BD4E1|aroE]
    description
    [Pubmed|21815947]

    regulatory mechanism

  • [protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB]: termination/antitermination, [pubmed|1551827], in [regulon|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB regulon]
  • regulation

  • not expressed if tryptophan is available ([protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB]) [Pubmed|1551827]
  • the mRNA is substantially stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • view in new tab

    genes
    [gene|4D7D62B4CDA350DCDC04E6934B5E23ECE4C57870|hisC]-[gene|DEB8358CE34F80560BE91F036659EF2C67A19623|tyrA]-[gene|CA00DFB480CBDC8AC31559958EF8E97E1E9BD4E1|aroE]
    description
    [Pubmed|21815947]

    additional information

  • the mRNA is substantially stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • view in new tab

    Biological materials

    Mutant

  • BKE22620 ([gene|4D7D62B4CDA350DCDC04E6934B5E23ECE4C57870|hisC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCTTTGATACGCAAATCAG, downstream forward: _UP4_TAAGAGGTGATCAAATATCA
  • BKK22620 ([gene|4D7D62B4CDA350DCDC04E6934B5E23ECE4C57870|hisC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCTTTGATACGCAAATCAG, downstream forward: _UP4_TAAGAGGTGATCAAATATCA
  • References

    Reviews

  • 12966138
  • Original publications

  • 4431,824269,11518529,3924737,6436812,1551827,8419914,21815947,23540922