SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


histidinol-phosphate aminotransferase / tyrosine and phenylalanine aminotransferase
39.93 kDa
protein length
360 aa Sequence Blast
gene length
1083 bp Sequence Blast
biosynthesis of aromatic amino acids
histidinol-phosphate aminotransferase / tyrosine and phenylalanine aminotransferase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of aromatic amino acids]
  • Gene

    2,370,415 2,371,497

    The protein

    Catalyzed reaction/ biological activity

  • 2-oxoglutarate + L-histidinol phosphate --> 3-(imidazol-4-yl)-2-oxopropyl phosphate + L-glutamate (according to UniProt)
  • Protein family

  • [SW|class-II pyridoxal-phosphate-dependent aminotransferase family] (according to UniProt)
  • [SW|Cofactors]

  • PLP (according to UniProt)
  • Structure

  • [PDB|3FFH] (from ''Listeria innocua'', 52% identity)
  • Expression and Regulation



    regulatory mechanism

  • [protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB]: termination/antitermination, [pubmed|1551827], in [regulon|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB regulon]
  • regulation

  • not expressed if tryptophan is available ([protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB]) [Pubmed|1551827]
  • the mRNA is substantially stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • view in new tab


    additional information

  • the mRNA is substantially stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • view in new tab

    Biological materials


  • BKE22620 ([gene|4D7D62B4CDA350DCDC04E6934B5E23ECE4C57870|hisC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCTTTGATACGCAAATCAG, downstream forward: _UP4_TAAGAGGTGATCAAATATCA
  • BKK22620 ([gene|4D7D62B4CDA350DCDC04E6934B5E23ECE4C57870|hisC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCTTTGATACGCAAATCAG, downstream forward: _UP4_TAAGAGGTGATCAAATATCA
  • References


  • 12966138
  • Original publications

  • 4431,824269,11518529,3924737,6436812,1551827,8419914,21815947,23540922