SubtiBank SubtiBank
comS
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

comS

antiadaptor protein, assembly link between regulatory components of the competence signal transduction pathway
locus
BSU_03500
pI
9.15
mw
5.11 kDa
protein length
gene length
141 bp Sequence Blast
function
control of ComK degradation
product
antiadaptor protein (anti-MecA)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • [category|SW 6|Groups of genes] → [category|SW 6.8|Short peptides]
  • Gene

    Coordinates
    390,880 391,020

    Phenotypes of a mutant

  • loss of [SW|genetic competence] [Pubmed|7752896]
  • overexpression of [protein|4D76F07D6124D56C7CEBBDAB9E84B2718BF1E7FC|ComS] results in expression of competence genes in 80% to 90% of the cells [Pubmed|8878039]
  • Expression and Regulation

    Operons

    genes
    [gene|81845F44CE2C601555066E31E87384FF5D7B4139|srfAA]-[gene|3C484FDB3A440269E87D6B6E8500A875AC456666|srfAB]-[gene|4D76F07D6124D56C7CEBBDAB9E84B2718BF1E7FC|comS]-[gene|1D5F227860A321506A1AB4BAE63CAD3A66E43BFC|srfAC]-[gene|9D0914FC38FFF4028C2BA5970DC87B3A1027E253|srfAD]
    description
    [Pubmed|1715856]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1715856], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|25666134], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|8830686], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA]: activation, [Pubmed|1715856,16091051], in [regulon|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA regulon]
  • [protein|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR]: activation, [Pubmed|16166527], in [regulon|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR regulon]
  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: repression, [Pubmed|12642660], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • [protein|5872812AB61E92E2944E926915EB7FEE71BFA6D5|Abh]: repression, [Pubmed|20817675], in [regulon|5872812AB61E92E2944E926915EB7FEE71BFA6D5|Abh regulon]
  • regulation

  • expressed at high cell density ([protein|search|ComA]) [Pubmed|16091051]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|hxlR]' and '[protein|search|srfAA]' [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • BKE03500 ([gene|4D76F07D6124D56C7CEBBDAB9E84B2718BF1E7FC|comS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03500 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTGCCTGATCGGTTCAAACG, downstream forward: _UP4_AAGTAGATAAAGACCGGCTTG
  • BKK03500 ([gene|4D76F07D6124D56C7CEBBDAB9E84B2718BF1E7FC|comS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03500 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTGCCTGATCGGTTCAAACG, downstream forward: _UP4_AAGTAGATAAAGACCGGCTTG
  • References

    Reviews

  • 19609260
  • Original Publications

  • 17560370,10447896,12642660,9000055,10361283,10447896,11703662,1715856,16091051,20817675,8878039,7752896,27045827