SubtiBank SubtiBank
ydzU
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ydzU

unknown
locus
BSU_06048
pI
9.00
mw
10.00 kDa
protein length
gene length
273 bp Sequence Blast
function
unknown
product
unknown
essential
-
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.5|Prophage 3]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    654,071 654,343

    Biological materials

    Mutant

  • BKE06048 ([gene|4D67B1EA37A0BDEA8653A73D0097241189234D35|ydzU]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06048 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATGTGTAGCAAATTTAA, downstream forward: _UP4_ACGGTAATCAAGAATAGCGG
  • BKK06048 ([gene|4D67B1EA37A0BDEA8653A73D0097241189234D35|ydzU]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06048 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATGTGTAGCAAATTTAA, downstream forward: _UP4_ACGGTAATCAAGAATAGCGG