SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


12.71 kDa
protein length
111 aa Sequence Blast
gene length
336 bp Sequence Blast

Genomic Context



  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.5|Prophage 3]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    663,601 663,936

    Biological materials


  • MGNA-C210 (ydjB::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE06120 ([gene|4D5D0363035C8C3283BFCF36557CA23C0EB7B9A4|ydjB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAGACGAGTTCCTTA, downstream forward: _UP4_TAATTGAATCTCATATTCTT
  • BKK06120 ([gene|4D5D0363035C8C3283BFCF36557CA23C0EB7B9A4|ydjB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAGACGAGTTCCTTA, downstream forward: _UP4_TAATTGAATCTCATATTCTT