SubtiBank SubtiBank
ydjB
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ydjB

unknown
locus
BSU_06120
pI
4.87
mw
12.71 kDa
protein length
111 aa Sequence Blast
gene length
336 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.5|Prophage 3]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    663,601 663,936

    Biological materials

    Mutant

  • MGNA-C210 (ydjB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2208 NBRP B. subtilis, Japan]
  • BKE06120 ([gene|4D5D0363035C8C3283BFCF36557CA23C0EB7B9A4|ydjB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAGACGAGTTCCTTA, downstream forward: _UP4_TAATTGAATCTCATATTCTT
  • BKK06120 ([gene|4D5D0363035C8C3283BFCF36557CA23C0EB7B9A4|ydjB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAGACGAGTTCCTTA, downstream forward: _UP4_TAATTGAATCTCATATTCTT