SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


19.94 kDa
protein length
167 aa Sequence Blast
gene length
504 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    1,266,614 1,267,117

    The protein


  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|15033535], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • view in new tab

    Biological materials


  • MGNA-A271 (yjcP::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE11940 ([gene|4D4BC14E558C05803A66EB1857E8F7D582AE54B7|yjcP]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTACAATTCACTCCCA, downstream forward: _UP4_TCTAAAGACTGAAAGGAGAA
  • BKK11940 ([gene|4D4BC14E558C05803A66EB1857E8F7D582AE54B7|yjcP]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTACAATTCACTCCCA, downstream forward: _UP4_TCTAAAGACTGAAAGGAGAA
  • References

  • 15033535