SubtiBank SubtiBank
yjcP
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yjcP

unknown
locus
BSU_11940
pI
9.70
mw
19.94 kDa
protein length
167 aa Sequence Blast
gene length
504 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,266,614 1,267,117

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|4D4BC14E558C05803A66EB1857E8F7D582AE54B7|yjcP]-[gene|AB905AFBB810E97CF91E141E7B69352014A5488B|yjcQ]
    description
    [Pubmed|15033535]

    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|15033535], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A271 (yjcP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/271 NBRP B. subtilis, Japan]
  • BKE11940 ([gene|4D4BC14E558C05803A66EB1857E8F7D582AE54B7|yjcP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTACAATTCACTCCCA, downstream forward: _UP4_TCTAAAGACTGAAAGGAGAA
  • BKK11940 ([gene|4D4BC14E558C05803A66EB1857E8F7D582AE54B7|yjcP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTACAATTCACTCCCA, downstream forward: _UP4_TCTAAAGACTGAAAGGAGAA
  • References

  • 15033535