SubtiBank SubtiBank
yurI
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yurI

ribonuclease, extracellular RNase Bsn
locus
BSU_32540
pI
4.87
mw
31.94 kDa
protein length
288 aa Sequence Blast
gene length
867 bp Sequence Blast
function
extracellular RNA degradation
product
extracellular RNase Bsn
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.3|Phosphate metabolism]
  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.4|RNases] → [category|SW 3.2.4.2|Endoribonucleases]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    3,344,113 3,344,979

    The protein

    [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation

    Operons

    genes
    [gene|4D46B2842D6B8B8002F47544E76DB36C24364E69|yurI]
    description
    [Pubmed|16291680]

    regulatory mechanism

  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|16291680], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • expressed under conditions of phosphate limitation ([protein|search|PhoP]) [Pubmed|16291680]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A552 (yurI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/552 NBRP B. subtilis, Japan]
  • BKE32540 ([gene|4D46B2842D6B8B8002F47544E76DB36C24364E69|yurI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACTTGCCCTCCTTTTA, downstream forward: _UP4_TAAGAAAAAGGTGCTCCTTT
  • BKK32540 ([gene|4D46B2842D6B8B8002F47544E76DB36C24364E69|yurI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACTTGCCCTCCTTTTA, downstream forward: _UP4_TAAGAAAAAGGTGCTCCTTT
  • References

    Reviews

  • 31464530
  • Original Publications

  • 16291680,18957862,12490701,1396690,20709850,20817675,25666134