SubtiBank SubtiBank
bacE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

bacE

efflux protein for bacilysin excretion, self-protection against bacilysin
locus
BSU37700
pI
9.22
mw
43.26 kDa
protein length
394 aa Sequence Blast
gene length
1185 bp Sequence Blast
function
self-protection to bacilysin
product
efflux protein for bacilysin excretion
essential
no
synonyms
ywfF,ipa-84d

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.1|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,869,487 3,870,671

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|3F49F4AEFC49C2883EFA60FEB3E77591F184195B|bacA]-[gene|0EEE23875DB720D256D53F00D1AD5EF24B538B27|bacB]-[gene|20A7DBA142F3BF8DCAD9732BD908CE8CC79AA993|bacC]-[gene|2CE0C0484A70EEE40277996CD3D564A84FEAF5B3|bacD]-[gene|4D2AD84E74888EC61E44DE5B8E31812F43250B05|bacE]-[gene|99434727013FCCD6E570AE550560A8546F7F2A41|bacF]
    description
    [Pubmed|12372825]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|19801406], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12372825,21709425], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|12697329,21709425], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC]: repression, [Pubmed|19801406], in [regulon|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC regulon]
  • regulation

  • expression of the operon is strongly induced at the beginning of [SW|biofilm formation] [pubmed|31113899]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A513 (ywfF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/513 NBRP B. subtilis, Japan]
  • BKE37700 ([gene|4D2AD84E74888EC61E44DE5B8E31812F43250B05|bacE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTAGAGTTGGGTTTCAGCT, downstream forward: _UP4_ACGGAGCAAAAAGGAGTCTT
  • BKK37700 ([gene|4D2AD84E74888EC61E44DE5B8E31812F43250B05|bacE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTAGAGTTGGGTTTCAGCT, downstream forward: _UP4_ACGGAGCAAAAAGGAGTCTT
  • References

  • 15609023,12372825,19801406,21948839