SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


efflux protein for bacilysin excretion, self-protection against bacilysin
43.26 kDa
protein length
394 aa Sequence Blast
gene length
1185 bp Sequence Blast
self-protection to bacilysin
efflux protein for bacilysin excretion

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,869,487 3,870,671

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|19801406], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12372825,21709425], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|12697329,21709425], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC]: repression, [Pubmed|19801406], in [regulon|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC regulon]
  • regulation

  • expression of the operon is strongly induced at the beginning of [SW|biofilm formation] [pubmed|31113899]
  • view in new tab

    Biological materials


  • MGNA-A513 (ywfF::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE37700 ([gene|4D2AD84E74888EC61E44DE5B8E31812F43250B05|bacE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTAGAGTTGGGTTTCAGCT, downstream forward: _UP4_ACGGAGCAAAAAGGAGTCTT
  • BKK37700 ([gene|4D2AD84E74888EC61E44DE5B8E31812F43250B05|bacE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTAGAGTTGGGTTTCAGCT, downstream forward: _UP4_ACGGAGCAAAAAGGAGTCTT
  • References

  • 15609023,12372825,19801406,21948839