SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


ATP-dependent helicase, part of a novel nucleotide excision repair pathway
84.40 kDa
protein length
749 aa Sequence Blast
gene length
2250 bp Sequence Blast
mitomycin C-specific DNA damage repair

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW|Other proteins]
  • Gene

    2,334,581 2,336,830

    Phenotypes of a mutant

  • sensitive to mitomycin C [pubmed|30379365]
  • The protein

    Protein family

  • [SW|helicase family] (according to UniProt)
  • [SW|Domains]

  • [SW|Helicase ATP-binding domain] (aa 63-243) (according to UniProt)
  • [SW|Helicase C-terminal domain] (aa 276-430) (according to UniProt)
  • Structure

  • [PDB|2P6R] (the N-terminal domain, corresponds to aa 31 ... 451 of MrfA, 25% identity) [pubmed|17558417]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A412 (yprA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE22220 ([gene|4D286C045A43FBF0F6E93E9E46AD7F25E35ADA7C|mrfA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTTTACACCTCTTTGT, downstream forward: _UP4_ATGTCGTAAGGAGGGAGGCC
  • BKK22220 ([gene|4D286C045A43FBF0F6E93E9E46AD7F25E35ADA7C|mrfA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTTTACACCTCTTTGT, downstream forward: _UP4_ATGTCGTAAGGAGGGAGGCC
  • References

    Research papers

  • 30379365,17558417