SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


bacillithiol S-transferase
20.52 kDa
protein length
178 aa Sequence Blast
gene length
537 bp Sequence Blast
bacillithiol S-transferase

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    913,924 914,460

    The protein

    Protein family

  • [SW|S-transferase-like (STL) superfamily] [pubmed|29451913]
  • metal hydrolase YfiT family (single member, according to UniProt)
  • [SW|Cofactors]

  • Ni(2+) [Pubmed|15581359]
  • Structure

  • [PDB|1RXQ] [pubmed|15581359]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-C307 (yfiT::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE08390 ([gene|4CF981E8DFBF07A8E7AF8623788A5812328E54BE|bstA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAATGTTCTCCCTTCTA, downstream forward: _UP4_CTTTCCAGACGGATGGGGTG
  • BKK08390 ([gene|4CF981E8DFBF07A8E7AF8623788A5812328E54BE|bstA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAATGTTCTCCCTTCTA, downstream forward: _UP4_CTTTCCAGACGGATGGGGTG
  • References

  • 15581359,22059487,24821014,29451913