SubtiBank SubtiBank
bstA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

bstA

bacillithiol S-transferase
locus
BSU08390
pI
6.61
mw
20.52 kDa
protein length
178 aa Sequence Blast
gene length
537 bp Sequence Blast
function
detoxification
product
bacillithiol S-transferase
essential
no
synonyms
yfiT

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    913,924 914,460

    The protein

    Protein family

  • [SW|S-transferase-like (STL) superfamily] [pubmed|29451913]
  • [SW|Cofactors]

  • Ni(2+) [Pubmed|15581359]
  • Structure

  • [PDB|1RXQ] [pubmed|15581359]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|4CF981E8DFBF07A8E7AF8623788A5812328E54BE|bstA]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C307 (yfiT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2305 NBRP B. subtilis, Japan]
  • BKE08390 ([gene|4CF981E8DFBF07A8E7AF8623788A5812328E54BE|bstA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08390 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAATGTTCTCCCTTCTA, downstream forward: _UP4_CTTTCCAGACGGATGGGGTG
  • BKK08390 ([gene|4CF981E8DFBF07A8E7AF8623788A5812328E54BE|bstA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08390 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAATGTTCTCCCTTCTA, downstream forward: _UP4_CTTTCCAGACGGATGGGGTG
  • References

  • 15581359,22059487,24821014,29451913