SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


transcriptional activator of the [gene|1CFF7202AC6078B6BAD1253F77FD4FE227C046DB|ptb]-[gene|A52E50104B18D0A8518218C52D9CC36FDDB29AAF|bcd]-[gene|8E08A0333E4EC89003DA3C1DD8DCD39CDDC8624C|buk]-[gene|1FD06CB6E81C920EFC656DBE2A13D68B1AA68872|lpdV]-[gene|9F298088C0A9EB7FE140C935AFC9243C6D4DE8AE|bkdAA]-[gene|A024921961A786294199EA12E04456C890ED8D8C|bkdAB]-[gene|262C9FD20C7A70B6F1FEB57735FA800F38EAB25A|bkdB] operon
77.75 kDa
protein length
692 aa Sequence Blast
gene length
2079 bp Sequence Blast
regulation of branched-chain amino acid utilization
transcriptional activator (for [protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL]-dependent promoter)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW|Utilization of branched-chain amino acids]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • Gene

    2,504,789 2,506,867

    Phenotypes of a mutant

  • cold-sensitive [pubmed|16585774]
  • The protein

    Protein family

  • [SW|Transcription factors activating transcription at SigL-dependent promoters]
  • [SW|Domains]

  • 2 [SW|PAS domain]s (aa 115-185, aa 234-305) (according to UniProt)
  • [SW|Sigma-54 factor interaction domain] (aa 368-598) (according to UniProt)
  • Structure

  • [PDB|1OJL] (ZraR from Salmonella typhimurium, C-terminal interaction domain, corresponds to aa 368 ... 683 of BkdR, 41% identity) [pubmed|16005641]
  • Expression and Regulation



    regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|10094682], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • repressed during growth in the presence of branched chain amino acids ([protein|search|CodY]) [Pubmed|10094682]
  • view in new tab

    Biological materials


  • MGNA-C375 (yqiR::erm), available at the [ NBRP B. subtilis, Japan]
  • 1A913 ( ''bkdR''::''kan''), [Pubmed|16585774], available at [ BGSC] and in [SW|Jörg Stülke]'s lab
  • BKE24100 ([gene|4CEBD81F485DD0B660E297FFC34A0F5270652184|bkdR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCCGATACCCCTTTGTA, downstream forward: _UP4_TAATTTGCAGAATAAACGCA
  • BKK24100 ([gene|4CEBD81F485DD0B660E297FFC34A0F5270652184|bkdR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCCGATACCCCTTTGTA, downstream forward: _UP4_TAATTTGCAGAATAAACGCA
  • References

  • 16585774,10094682,23123912,12823818,21906631,16005641