SubtiBank SubtiBank
yhjD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yhjD

unknown
locus
BSU_10470
pI
5.67
mw
14.32 kDa
protein length
120 aa Sequence Blast
gene length
363 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,121,036 1,121,398

    Expression and Regulation

    Operons

    genes
    [gene|4CE149CB9FDC412AF28812D21A0A514ECA997124|yhjD]
    description
    (according to [http://dbtbs.hgc.jp/COG/prom/yhjD.html DBTBS]) null

    regulatory mechanism

  • [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]: repression, [Pubmed|16267290], in [regulon|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA regulon]
  • regulation

  • induced upon DNA damage ([protein|search|LexA]) [Pubmed|16267290]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B284 (yhjD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1283 NBRP B. subtilis, Japan]
  • BKE10470 ([gene|4CE149CB9FDC412AF28812D21A0A514ECA997124|yhjD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10470 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTGACTCCTTCTTTCT, downstream forward: _UP4_TGAGCCTTTTGAATCATACT
  • BKK10470 ([gene|4CE149CB9FDC412AF28812D21A0A514ECA997124|yhjD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10470 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTGACTCCTTCTTTCT, downstream forward: _UP4_TGAGCCTTTTGAATCATACT
  • References

  • 16267290