SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to metabolite transport protein
43.89 kDa
protein length
430 aa Sequence Blast
gene length
1293 bp Sequence Blast

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Other transporters]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    566,211 567,503

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Biological materials


  • MGNA-C130 (ydeG::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE05190 ([gene|4CDEE1AD400AD49D5B34C5FE2010B8F47BB37E38|ydeG]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGACCTTCCTTTCTAA, downstream forward: _UP4_TAAAGGGTAGGATTGTTTAA
  • BKK05190 ([gene|4CDEE1AD400AD49D5B34C5FE2010B8F47BB37E38|ydeG]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGACCTTCCTTTCTAA, downstream forward: _UP4_TAAAGGGTAGGATTGTTTAA