SubtiBank SubtiBank
ydeG
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ydeG

similar to metabolite transport protein
locus
BSU_05190
pI
9.75
mw
43.89 kDa
protein length
430 aa Sequence Blast
gene length
1293 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.12|Other transporters]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    566,211 567,503

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Biological materials

    Mutant

  • MGNA-C130 (ydeG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2128 NBRP B. subtilis, Japan]
  • BKE05190 ([gene|4CDEE1AD400AD49D5B34C5FE2010B8F47BB37E38|ydeG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05190 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGACCTTCCTTTCTAA, downstream forward: _UP4_TAAAGGGTAGGATTGTTTAA
  • BKK05190 ([gene|4CDEE1AD400AD49D5B34C5FE2010B8F47BB37E38|ydeG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05190 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGACCTTCCTTTCTAA, downstream forward: _UP4_TAAAGGGTAGGATTGTTTAA