SubtiBank SubtiBank
ydeG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ydeG

similar to metabolite transport protein
locus
BSU_05190
pI
9.75
mw
43.89 kDa
protein length
430 aa Sequence Blast
gene length
1293 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.12|Other transporters]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    566,211 567,503

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Biological materials

    Mutant

  • MGNA-C130 (ydeG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2128 NBRP B. subtilis, Japan]
  • BKE05190 ([gene|4CDEE1AD400AD49D5B34C5FE2010B8F47BB37E38|ydeG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05190 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGACCTTCCTTTCTAA, downstream forward: _UP4_TAAAGGGTAGGATTGTTTAA
  • BKK05190 ([gene|4CDEE1AD400AD49D5B34C5FE2010B8F47BB37E38|ydeG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05190 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGACCTTCCTTTCTAA, downstream forward: _UP4_TAAAGGGTAGGATTGTTTAA