SubtiBank SubtiBank
ydiR

ydiR

component of the BsuM DNA restriction system
locus
BSU_06090
pI
4.39
mw
35.16 kDa
protein length
313 aa Sequence Blast
gene length
942 bp Sequence Blast
function
BsuM DNA restriction
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.4|DNA restriction/ modification]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.5|Prophage 3]
  • Gene

    Coordinates
    659,623 660,564

    The protein

    Catalyzed reaction/ biological activity

  • Endonucleolytic cleavage of DNA to give specific double-stranded fragments with terminal 5'-phosphates (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|4BD4CFB10700907DF1BBF3C9CFACAF573588E85F|ydiR]-[gene|A8C606348C8C6FC3BB9786C06C9BFE9D3519A041|ydiS]-[gene|D36B91B3C8EAFEB80A7395C62A50A5F80B8CC5C5|ydjA]
    description
    [Pubmed|11751814]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C207 (ydiR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2205 NBRP B. subtilis, Japan]
  • BKE06090 ([gene|4BD4CFB10700907DF1BBF3C9CFACAF573588E85F|ydiR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGATTTTACCCCCATAA, downstream forward: _UP4_TAAGCGATAAACTTTAAATA
  • BKK06090 ([gene|4BD4CFB10700907DF1BBF3C9CFACAF573588E85F|ydiR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGATTTTACCCCCATAA, downstream forward: _UP4_TAAGCGATAAACTTTAAATA
  • References

  • 11751814,22092861