SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


cytochrome P450 (CYP102A3)/ NADPH-cytochrome P450 reductase
118.47 kDa
protein length
1054 aa Sequence Blast
gene length
3165 bp Sequence Blast
fatty acid metabolism
NADPH-cytochrome P450 reductase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.3|Electron transport/ other]
  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.3|Lipid metabolism/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    2,773,890 2,777,054

    The protein

    Catalyzed reaction/ biological activity

  • hydroxylates medium-chain fatty acids in subterminal positions [Pubmed|14741768]
  • Protein family

  • [SW|cytochrome P450] family (according to UniProt)
  • Paralogous protein(s)

  • [protein|9AA8CAEB42B1ED4CC8D80D57B045A55307114D6A|YetO]
  • Structure

  • [PDB|2X7Y] (from Bacillus megaterium; 67% identity, 88% similarity) [Pubmed|25325618,22949185]
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421,12775685], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|12207695], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • [protein|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV]: sigma factor, in [regulon|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV regulon]
  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, [Pubmed|9636707], in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]
  • regulatory mechanism

  • [protein|3DA3FFB295F5513A220CB163994EE0F356C810E6|FatR]: repression, [Pubmed|11734890], in [regulon|3DA3FFB295F5513A220CB163994EE0F356C810E6|FatR regulon]
  • regulation

  • expression is reduced in a [protein|search|SigV] mutant [Pubmed|21926231]
  • additional information

  • A [protein|search|ncRNA] ([SW|RnaC]) is encoded between '[protein|search|yrhK]' and '[protein|search|yrhJ]' [PubMed|25790031]
  • view in new tab



  • Expressed under stress conditions ([protein|search|SigW], [protein|search|SigX]) [Pubmed|9683469]
  • additional information

  • A [protein|search|ncRNA] ([SW|RnaC]) is encoded between '[protein|search|yrhK]' and '[protein|search|yrhJ]' [PubMed|25790031]
  • view in new tab

    Biological materials


  • MGNA-A163 (yrhJ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE27160 ([gene|4BA5214C441C6671CB7DAA3CACBCA5FC025BE0E6|yrhJ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTGTTTCATTAACATCTCCC, downstream forward: _UP4_TAAAATATAAAATCCCGCCA
  • BKK27160 ([gene|4BA5214C441C6671CB7DAA3CACBCA5FC025BE0E6|yrhJ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTGTTTCATTAACATCTCCC, downstream forward: _UP4_TAAAATATAAAATCCCGCCA
  • References

  • 11734890,10917605,11574077,14741768,15122913,12775685,16716428,16381045,20525796,12207695,9636707,21926231,25325618,22949185,25790031