SubtiBank SubtiBank
ypoC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ypoC

unknown
locus
BSU22330
pI
6.48
mw
19.20 kDa
protein length
164 aa Sequence Blast
gene length
495 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
jooC

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,344,264 2,344,758

    The protein

    Modification

  • phosphorylation on Ser-117 [Pubmed|17218307]
  • Expression and Regulation

    Operons

    genes
    [gene|FBA7EAA70F5C9E76463B0C5F85D65D4314FFD40D|asnS]-[gene|C9FEE07601AD28B2651EB881A1D9B34D5082237C|dnaD]-[gene|C352560155F5B2E951B5059794D7B319C1A3AF2C|nth]-[gene|4B2A124B726393544A47791E5A5681F7B766A588|ypoC]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A442 (ypoC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/442 NBRP B. subtilis, Japan]
  • BKE22330 ([gene|4B2A124B726393544A47791E5A5681F7B766A588|ypoC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22330 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGTCATCGTTTCACCAGTCC, downstream forward: _UP4_TAAAACCTCCTGTTAAAACG
  • BKK22330 ([gene|4B2A124B726393544A47791E5A5681F7B766A588|ypoC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22330 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGTCATCGTTTCACCAGTCC, downstream forward: _UP4_TAAAACCTCCTGTTAAAACG
  • References

  • 17218307