SubtiBank SubtiBank
ypoC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ypoC

unknown
locus
BSU_22330
pI
6.48
mw
19.20 kDa
protein length
164 aa Sequence Blast
gene length
495 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
jooC

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,344,264 2,344,758

    The protein

    Modification

  • phosphorylation on Ser-117 [Pubmed|17218307]
  • Expression and Regulation

    Operons

    genes
    [gene|FBA7EAA70F5C9E76463B0C5F85D65D4314FFD40D|asnS]-[gene|C9FEE07601AD28B2651EB881A1D9B34D5082237C|dnaD]-[gene|C352560155F5B2E951B5059794D7B319C1A3AF2C|nth]-[gene|4B2A124B726393544A47791E5A5681F7B766A588|ypoC]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A442 (ypoC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/442 NBRP B. subtilis, Japan]
  • BKE22330 ([gene|4B2A124B726393544A47791E5A5681F7B766A588|ypoC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22330 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGTCATCGTTTCACCAGTCC, downstream forward: _UP4_TAAAACCTCCTGTTAAAACG
  • BKK22330 ([gene|4B2A124B726393544A47791E5A5681F7B766A588|ypoC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22330 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGTCATCGTTTCACCAGTCC, downstream forward: _UP4_TAAAACCTCCTGTTAAAACG
  • References

  • 17218307