SubtiBank SubtiBank
ygzA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ygzA

unknown
locus
BSU_08770
pI
4.27
mw
7.64 kDa
protein length
gene length
204 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    954,291 954,494

    Expression and Regulation

    Operons

    genes
    [gene|4AE313943886C1E31837E3AD1D308E71C2A1551E|ygzA]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE08770 ([gene|4AE313943886C1E31837E3AD1D308E71C2A1551E|ygzA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGACTCCTTTATTTTCA, downstream forward: _UP4_TAAAAAAGAGACGGCATCTC
  • BKK08770 ([gene|4AE313943886C1E31837E3AD1D308E71C2A1551E|ygzA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGACTCCTTTATTTTCA, downstream forward: _UP4_TAAAAAAGAGACGGCATCTC