SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


lipid carrier sugar transferase, disrupted pseudogene in B. subtilis 168
0.00 kDa
protein length
gene length
150 bp Sequence Blast
biosynthesis of teichuronic acid
lipid carrier sugar transferase

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW|Biosynthesis of teichuronic acid]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW|Biosynthesis of teichuronic acid]
  • [category|SW 6|Groups of genes] → [category|SW 6.10|Pseudogenes]
  • Gene

    3,658,259 3,658,408

    The protein

    Catalyzed reaction/ biological activity

  • di-trans,octa-cis-undecaprenyl phosphate + UDP-N-acetyl-α-D-galactosamine --> N-acetyl-α-D-galactosaminyl-1-diphospho-di-trans,octa-cis-undecaprenol + UMP (according to UniProt)
  • Protein family

  • Bacterial sugar transferase family (with [protein|D67665412B78B56752B460219445E4BEF52C3A1A|EpsL], according to UniProt)
  • Paralogous protein(s)

  • [protein|D67665412B78B56752B460219445E4BEF52C3A1A|EpsL]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10048024], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|16497325,15699190], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulatory mechanism

  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|9611818,10627039], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • regulation

  • expressed during [SW|sporulation] in the forespore ([protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]) [Pubmed|16497325,15699190]
  • view in new tab

    Biological materials


  • BKE35609 ([gene|4AC72C556ED02A7DE4E1E8D69A0FC926359ACE28|tuaA/1]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCGTAACCGCCGTTCACCT, downstream forward: _UP4_TAAAACGGGATTCCATTATT
  • BKK35609 ([gene|4AC72C556ED02A7DE4E1E8D69A0FC926359ACE28|tuaA/1]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCGTAACCGCCGTTCACCT, downstream forward: _UP4_TAAAACGGGATTCCATTATT
  • References

  • 9683503,9611818,10627039,10048024,25666134