SubtiBank SubtiBank
tuaA/1
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

tuaA/1

lipid carrier sugar transferase, disrupted pseudogene in B. subtilis 168
locus
BSU_35609
pI
0.00
mw
0.00 kDa
protein length
gene length
150 bp Sequence Blast
function
biosynthesis of teichuronic acid
product
lipid carrier sugar transferase
essential
no
synonyms
yvhA

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW 1.1.1.5|Biosynthesis of teichuronic acid]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW 2.6.1.4|Biosynthesis of teichuronic acid]
  • [category|SW 6|Groups of genes] → [category|SW 6.10|Pseudogenes]
  • Gene

    Coordinates
    3,658,259 3,658,408

    The protein

    Catalyzed reaction/ biological activity

  • di-trans,octa-cis-undecaprenyl phosphate + UDP-N-acetyl-α-D-galactosamine --> N-acetyl-α-D-galactosaminyl-1-diphospho-di-trans,octa-cis-undecaprenol + UMP (according to UniProt)
  • Protein family

  • Bacterial sugar transferase family (with [protein|D67665412B78B56752B460219445E4BEF52C3A1A|EpsL], according to UniProt)
  • Paralogous protein(s)

  • [protein|D67665412B78B56752B460219445E4BEF52C3A1A|EpsL]
  • Expression and Regulation

    Operons

    genes
    [gene|5790E3DB39F31017B557C2D3F428C0348A461DA6|tuaA/2]-[gene|4AC72C556ED02A7DE4E1E8D69A0FC926359ACE28|tuaA/1]-[gene|54F96DE549F78E6C1580949A21C84B27AF26C4C6|tuaB]-[gene|873EE7A8C9BBFC6E96B0957B450BA665E3C9222D|tuaC]-[gene|DF8CD0B3997A7A4CF4821A7D64E9898422FD17E0|tuaD]-[gene|B89FA71C2924CC0690224AFBFA06DB0FF0D97C0A|tuaE]-[gene|6F0FA23892BB1829174F66C464149DB428A8DE18|tuaF]-[gene|6E4F2BA67FF58085D462F6A6FB6497BDF600FCF6|tuaG]-[gene|737B37DA0DA1642AD5C4A824228BFED55FF0652A|tuaH]
    description
    [Pubmed|10048024]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10048024], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|16497325,15699190], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulatory mechanism

  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|9611818,10627039], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • regulation

  • expressed during [SW|sporulation] in the forespore ([protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]) [Pubmed|16497325,15699190]
  • view in new tab

    Biological materials

    Mutant

  • BKE35609 ([gene|4AC72C556ED02A7DE4E1E8D69A0FC926359ACE28|tuaA/1]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35609 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCGTAACCGCCGTTCACCT, downstream forward: _UP4_TAAAACGGGATTCCATTATT
  • BKK35609 ([gene|4AC72C556ED02A7DE4E1E8D69A0FC926359ACE28|tuaA/1]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35609 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCGTAACCGCCGTTCACCT, downstream forward: _UP4_TAAAACGGGATTCCATTATT
  • References

  • 9683503,9611818,10627039,10048024,25666134