SubtiBank SubtiBank
tuaA/1
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

tuaA/1

lipid carrier sugar transferase, disrupted pseudogene in B. subtilis 168
locus
BSU_35609
pI
0.00
mw
0.00 kDa
protein length
gene length
150 bp Sequence Blast
function
biosynthesis of teichuronic acid
product
lipid carrier sugar transferase
essential
no
synonyms
yvhA

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW 1.1.1.5|Biosynthesis of teichuronic acid]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW 2.6.1.4|Biosynthesis of teichuronic acid]
  • [category|SW 6|Groups of genes] → [category|SW 6.10|Pseudogenes]
  • Gene

    Coordinates
    3,658,259 3,658,408

    The protein

    Catalyzed reaction/ biological activity

  • di-trans,octa-cis-undecaprenyl phosphate + UDP-N-acetyl-α-D-galactosamine --> N-acetyl-α-D-galactosaminyl-1-diphospho-di-trans,octa-cis-undecaprenol + UMP (according to UniProt)
  • Protein family

  • Bacterial sugar transferase family (with [protein|D67665412B78B56752B460219445E4BEF52C3A1A|EpsL], according to UniProt)
  • Paralogous protein(s)

  • [protein|D67665412B78B56752B460219445E4BEF52C3A1A|EpsL]
  • Expression and Regulation

    Operons

    genes
    [gene|5790E3DB39F31017B557C2D3F428C0348A461DA6|tuaA/2]-[gene|4AC72C556ED02A7DE4E1E8D69A0FC926359ACE28|tuaA/1]-[gene|54F96DE549F78E6C1580949A21C84B27AF26C4C6|tuaB]-[gene|873EE7A8C9BBFC6E96B0957B450BA665E3C9222D|tuaC]-[gene|DF8CD0B3997A7A4CF4821A7D64E9898422FD17E0|tuaD]-[gene|B89FA71C2924CC0690224AFBFA06DB0FF0D97C0A|tuaE]-[gene|6F0FA23892BB1829174F66C464149DB428A8DE18|tuaF]-[gene|6E4F2BA67FF58085D462F6A6FB6497BDF600FCF6|tuaG]-[gene|737B37DA0DA1642AD5C4A824228BFED55FF0652A|tuaH]
    description
    [Pubmed|10048024]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10048024], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|16497325,15699190], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulatory mechanism

  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|9611818,10627039], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • regulation

  • expressed during [SW|sporulation] in the forespore ([protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]) [Pubmed|16497325,15699190]
  • view in new tab

    Biological materials

    Mutant

  • BKE35609 ([gene|4AC72C556ED02A7DE4E1E8D69A0FC926359ACE28|tuaA/1]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35609 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCGTAACCGCCGTTCACCT, downstream forward: _UP4_TAAAACGGGATTCCATTATT
  • BKK35609 ([gene|4AC72C556ED02A7DE4E1E8D69A0FC926359ACE28|tuaA/1]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35609 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCGTAACCGCCGTTCACCT, downstream forward: _UP4_TAAAACGGGATTCCATTATT
  • References

  • 9683503,9611818,10627039,10048024,25666134