SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


glutamine phosphoribosyldiphosphate amidotransferase
51.45 kDa
protein length
476 aa Sequence Blast
gene length
1431 bp Sequence Blast
purine biosynthesis
glutamine phosphoribosyldiphosphate amidotransferase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW|Biosynthesis/ acquisition of purine nucleotides]
  • Gene

    705,441 706,871

    The protein

    Catalyzed reaction/ biological activity

  • 5-phospho-β-D-ribosylamine + diphosphate + L-glutamate --> 5-phospho-α-D-ribose 1-diphosphate + H2O + L-glutamine (according to UniProt)
  • Protein family

  • [SW|Purine/pyrimidine phosphoribosyltransferase family] (according to UniProt)
  • [SW|Cofactors]

  • Fe-S cluster [pubmed|29292548]
  • Structure

  • [PDB|1GPH], [PDB|1AO0] (complex with ADP and GMP)
  • Additional information

  • subject to Clp-dependent proteolysis upon glucose starvation [PubMed|17981983]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|3036807], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|G-box|G-box]: termination, ([SW|riboswitch]) [pubmed|3036807,12787499], in [regulon|G-box|G-box]
  • [protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR]: repression, (molecular inducer: PRPP) [Pubmed|7638212,2536750], in [regulon|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR regulon]
  • regulation

  • expression activated by glucose (4.4 fold) [Pubmed|12850135]
  • view in new tab

    Biological materials


  • BKE06490 ([gene|4AA5AF9C7CE8D0A9FD3A47650ECF130BCBEE1952|purF]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCCAAAAACGCCGCATTCTT, downstream forward: _UP4_TAAAACTTGAAAAATGACAT
  • BKK06490 ([gene|4AA5AF9C7CE8D0A9FD3A47650ECF130BCBEE1952|purF]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCCAAAAACGCCGCATTCTT, downstream forward: _UP4_TAAAACTTGAAAAATGACAT
  • References


  • 12859215,11395405
  • Original publications

  • 6315725,12923093,6794614,2553706,6401710,6771260,2495277,109433,6814966,6411716,6411717,6794613,3036807,8197456,7638212,25023436