SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


glutaredoxin-like thioredoxin
8.95 kDa
protein length
gene length
243 bp Sequence Blast

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.3|Electron transport/ other]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • Gene

    2,159,742 2,159,984

    The protein

    Protein family

  • [SW|Thioredoxin family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|4E5C84FDC8FE2FEFF47306C91ECAB7F17D3E38E9|TrxA]
  • [SW|Domains]

  • [SW|Thioredoxin domain] (aa 1-80) (according to UniProt)
  • Structure

  • [PDB|4BA7] (ancestral thioredoxin relative to Last Bacteria Common Ancestor (LBCA) from the precambrian period) (36% identity), [Pubmed|23932589]
  • Biological materials


  • BKE20030 ([gene|4A8B6D88FEA9D18E1BAE08847A5F7683F9D6CDF4|yosR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGGCTGCTCTAATTTAATTA, downstream forward: _UP4_TAAAAGGGTAATTTTAAACA
  • BKK20030 ([gene|4A8B6D88FEA9D18E1BAE08847A5F7683F9D6CDF4|yosR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGGCTGCTCTAATTTAATTA, downstream forward: _UP4_TAAAAGGGTAATTTTAAACA
  • References

  • 24401092,23932589