SubtiBank SubtiBank
thrC [2019-02-04 15:13:50]
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

thrC [2019-02-04 15:13:50]

threonine synthase
37.31 kDa
protein length
352 aa Sequence Blast
gene length
1059 bp Sequence Blast
biosynthesis of threonine
threonine synthase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of lysine/ threonine]
  • Gene

    3,313,770 3,314,828

    The protein

    Catalyzed reaction/ biological activity

  • O-phospho-L-homoserine + H2O --> L-threonine + phosphate (according to UniProt)
  • has additional threonine dehydratase activity [pubmed|27260660]
  • Protein family

  • threonine synthase family (according to UniProt)
  • [SW|Cofactors]

  • PLP
  • Structure

  • [PDB|1UIN] (from ''Thermus thermophilus'', 51% identity, 69% similarity) [Pubmed|12952961]
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation




  • expressed during [SW|sporulation] [Pubmed|22383849]
  • view in new tab


    regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|24163341], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: repression, [Pubmed|25755103], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • [protein|A4B7CF7A1C704C750AFAD97A43AF975260935083|ThrR]: repression, [Pubmed|27260660], in [regulon|A4B7CF7A1C704C750AFAD97A43AF975260935083|ThrR regulon]
  • regulation

  • expressed in the presence of lysine or cysteine ([SW|ThrR]) [Pubmed|27260660]
  • view in new tab

    Biological materials


  • GP3030 (''[gene|4A839F8A53DF75DF01FE410EBD3361759C3B1C86|thrC]''::''spec''), available in [SW|Jörg Stülke]'s lab
  • 1A773 ( ''thrC''::''cat''), [Pubmed|8973347], available at [ BGSC] and in [SW|Jrg Stlke]'s lab
  • BKE32250 ([gene|4A839F8A53DF75DF01FE410EBD3361759C3B1C86|thrC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTGATGGATAAGTCCTTTCC, downstream forward: _UP4_TATGTAAAAGGAGCGGCCCG
  • BKK32250 ([gene|4A839F8A53DF75DF01FE410EBD3361759C3B1C86|thrC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTGATGGATAAGTCCTTTCC, downstream forward: _UP4_TATGTAAAAGGAGCGGCCCG
  • References

  • 12107147,3098560,24163341,15378759,27260660