SubtiBank SubtiBank
thrC [2019-01-28 10:50:27]
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

thrC [2019-01-28 10:50:27]

threonine synthase
locus
BSU32250
pI
5.18
mw
37.31 kDa
protein length
352 aa Sequence Blast
gene length
1056 bp Sequence Blast
function
biosynthesis of threonine
product
threonine synthase
essential
no
ec
4.2.3.1
synonyms
thrB

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.6|Biosynthesis/ acquisition of lysine/ threonine]
  • Gene

    Coordinates
    3,313,770 → 3,314,828

    The protein

    Catalyzed reaction/ biological activity

  • O-phospho-L-homoserine + H2O --> L-threonine + phosphate (according to UniProt)
  • has additional threonine dehydratase activity [pubmed|27260660]
  • Protein family

  • threonine synthase family (according to UniProt)
  • Structure

  • [PDB|1UIN] (from ''Thermus thermophilus'', 51% identity, 69% similarity) [Pubmed|12952961]
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|0F40291BB10DB6D7DFD94B9C7D700F4410C4EE69|yutH]-[gene|11421D5BD3AB6C205DDA0864F878E2B04340033F|hom]-[gene|4A839F8A53DF75DF01FE410EBD3361759C3B1C86|thrC]-[gene|290302BA8A4E44C62AE3071C1F7DE18B20605607|thrB]
    description
    [Pubmed|22383849]

    regulation

  • expressed during [SW|sporulation] [Pubmed|22383849]
  • view in new tab

    genes
    [gene|11421D5BD3AB6C205DDA0864F878E2B04340033F|hom]-[gene|4A839F8A53DF75DF01FE410EBD3361759C3B1C86|thrC]-[gene|290302BA8A4E44C62AE3071C1F7DE18B20605607|thrB]
    description
    [Pubmed|12107147]

    regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|24163341], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: repression, [Pubmed|25755103], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • [protein|A4B7CF7A1C704C750AFAD97A43AF975260935083|ThrR]: repression, [Pubmed|27260660], in [regulon|A4B7CF7A1C704C750AFAD97A43AF975260935083|ThrR regulon]
  • regulation

  • expressed in the presence of lysine or cysteine ([SW|ThrR]) [Pubmed|27260660]
  • view in new tab

    Biological materials

    Mutant

  • 1A773 ( ''thrC''::''cat''), [Pubmed|8973347], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A773&Search=1A773 BGSC] and in [SW|Jörg Stülke]'s lab
  • BKE32250 (Δ[gene|4A839F8A53DF75DF01FE410EBD3361759C3B1C86|thrC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTGATGGATAAGTCCTTTCC, downstream forward: _UP4_TATGTAAAAGGAGCGGCCCG
  • BKK32250 (Δ[gene|4A839F8A53DF75DF01FE410EBD3361759C3B1C86|thrC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTGATGGATAAGTCCTTTCC, downstream forward: _UP4_TATGTAAAAGGAGCGGCCCG
  • References

  • 12107147,3098560,24163341,15378759,27260660