SubtiBank SubtiBank
iolT
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

iolT

major transporter for inositol
locus
BSU06230
pI
9.57
mw
51.47 kDa
protein length
473 aa Sequence Blast
gene length
1422 bp Sequence Blast
function
myo-inositol uptake
product
major transporter for inositol
essential
no
synonyms
ydjK

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.3|Carbohydrate transporter]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.16|Utilization of inositol]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    676,442 677,863

    The protein

    Catalyzed reaction/ biological activity

  • transport of myo-inositol [Pubmed|20530884]
  • Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|4A77316AA94F9C11DB70AB76711AACBD28098AA1|IolT], [protein|770D9A5BEEEABE9C3FC772E74001329206ECFAB3|AraE], [protein|7CE5A42042E5D52768735E795DB805530691D8A6|YwtG], [protein|8B0701B5694ABA8142476CB896E590FE1981D7DB|YfiG], [protein|A84AC4E40E7C722E27AE9C24ACECFEABD51B57BE|YncC], [protein|0757FAEB38AA1C599C5067794AF83A4BA5912DC9|CsbC], [protein|4A77316AA94F9C11DB70AB76711AACBD28098AA1|IolT]
  • Structure

  • [PDB|4LDS] (glucose transporter from Staphylococcus epidermidis, 36% identity) [pubmed|24127585]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|4A77316AA94F9C11DB70AB76711AACBD28098AA1|iolT]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|IolR]: repression, [pubmed|11807058], in [regulon|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|IolR regulon]
  • regulation

  • induced in the presence of inositol ([protein|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|IolR]) [Pubmed|11807058]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C218 (ydjK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2216 NBRP B. subtilis, Japan]
  • BKE06230 ([gene|4A77316AA94F9C11DB70AB76711AACBD28098AA1|iolT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACTGTTTCCCCCAGTCT, downstream forward: _UP4_TAATTTAAAAAAGAATCCGC
  • BKK06230 ([gene|4A77316AA94F9C11DB70AB76711AACBD28098AA1|iolT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACTGTTTCCCCCAGTCT, downstream forward: _UP4_TAATTTAAAAAAGAATCCGC
  • References

  • 11807058,20530884,28431560,24127585