SubtiBank SubtiBank
recS [2018-02-08T12:04:24.000Z]
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

recS [2018-02-08T12:04:24.000Z]

ATP-dependent DNA helicase
locus
BSU23020
pI
6.23
mw
56.34 kDa
protein length
496 aa Sequence Blast
gene length
1488 bp Sequence Blast
function
replication reactivation pathway
product
ATP-dependent DNA helicase
essential
no
synonyms
recS,ypbC

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • Gene

    Coordinates
    2,406,922 → 2,408,412

    The protein

    Protein family

  • RecQ subfamily (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|E6EA8098E37A4A2F7370920AC1A500EE4319AAA2|RecQ]
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Biological materials

    Mutant

  • 1A893 (no resistance), [Pubmed|16020779], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A893&Search=1A893 BGSC]
  • BKE23020 (Δ[gene|4A4FCD876C3CA1D821792803CA2A0CB2E97D3F5E|recS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAACTGATATAACGTTTGCT, downstream forward: _UP4_TGAAACAGCAAAAAGATTAT
  • BKK23020 (Δ[gene|4A4FCD876C3CA1D821792803CA2A0CB2E97D3F5E|recS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAACTGATATAACGTTTGCT, downstream forward: _UP4_TGAAACAGCAAAAAGATTAT
  • References

    Reviews

  • 12427530,21047263,22933559
  • Original publications

  • 17853894,25246477