SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


ATP-dependent DNA helicase
56.34 kDa
protein length
496 aa Sequence Blast
gene length
1491 bp Sequence Blast
replication reactivation pathway
ATP-dependent DNA helicase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • Gene

    2,406,922 2,408,412

    The protein

    Protein family

  • [SW|helicase family] (according to UniProt)
  • RecQ subfamily (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|E6EA8098E37A4A2F7370920AC1A500EE4319AAA2|RecQ]
  • Structure

  • [PDB|4Q47] ([protein|E6EA8098E37A4A2F7370920AC1A500EE4319AAA2|RecQ] from Deinococcus radiodurans, corresponds to aa 8 ... 394, 38% identity) [pubmed|25243132]
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • Biological materials


  • 1A893 (no resistance), [Pubmed|16020779], available at [ BGSC]
  • BKE23020 ([gene|4A4FCD876C3CA1D821792803CA2A0CB2E97D3F5E|recS]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAACTGATATAACGTTTGCT, downstream forward: _UP4_TGAAACAGCAAAAAGATTAT
  • BKK23020 ([gene|4A4FCD876C3CA1D821792803CA2A0CB2E97D3F5E|recS]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAACTGATATAACGTTTGCT, downstream forward: _UP4_TGAAACAGCAAAAAGATTAT
  • References


  • 12427530,21047263,22933559
  • Original publications

  • 17853894,25246477,25243132