SubtiBank SubtiBank
sspH [2019-06-25 11:02:14]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

sspH [2019-06-25 11:02:14]

small acid-soluble spore protein (minor)
6.73 kDa
protein length
gene length
180 bp Sequence Blast
protection of spore DNA
small acid-soluble spore protein (minor)

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Small acid-soluble spore proteins]
  • Gene

    885,629 885,808

    The protein

    Protein family

  • sspH family (according to Swiss-Prot)
  • [SW|Localization]

  • spore core (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15699190,10333516], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12850135], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • repressed by glucose (3.7-fold) ([protein|search|CcpA]) [Pubmed|12850135]
  • view in new tab


    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|22900538], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12850135], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • repressed by glucose (3.7-fold) ([protein|search|CcpA]) [Pubmed|12850135]
  • view in new tab

    additional information

  • the mRNA belongs to the 46 most abundant mRNA species in dormant spores [pubmed|30782632]
  • Biological materials


  • MGNA-C353 (yfjU::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE08110 ([gene|4A4A533542E47DE8114B697FADE4CB581E5FB66E|sspH]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTAACACCCTCCTTCA, downstream forward: _UP4_TAAACAAAAATGGCCCGCTT
  • BKK08110 ([gene|4A4A533542E47DE8114B697FADE4CB581E5FB66E|sspH]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTAACACCCTCCTTCA, downstream forward: _UP4_TAAACAAAAATGGCCCGCTT
  • References

  • 10333516,30782632