SubtiBank SubtiBank
tgl
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

tgl

outer spore coat protein, spore associated transglutaminase
locus
BSU_31270
pI
6.69
mw
28.15 kDa
protein length
245 aa Sequence Blast
gene length
738 bp Sequence Blast
function
introduction of crosslinks in the spore coat proteins [protein|1CA990DA55B6F879968C431A703E0478F5564A1A|GerQ] and [protein|CEBEC9CECCF445C40D793E61A2CD23175631A473|SafA]
product
spore associated transglutaminase
essential
no
ec
2.3.2.13
synonyms
yuxF,yugV

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.5|Class V]
  • Gene

    Coordinates
    3,212,591 3,213,328

    The protein

    Catalyzed reaction/ biological activity

  • cross-links [protein|CEBEC9CECCF445C40D793E61A2CD23175631A473|SafA] to other spore coat proteins [pubmed|29712873]
  • L-glutaminyl-[protein] + L-lysyl-[protein] --> [protein]-L-lysyl-N6-5-L-glutamyl-[protein] + NH4+ (according to UniProt)
  • temperature-dependent modification of the coat proteins such as [protein|1CA990DA55B6F879968C431A703E0478F5564A1A|GerQ] (together with [protein|A46D07F8F56249A04C5F880120D19F00C9CAE112|YabG]) [Pubmed|16751597]
  • Protein family

  • bacillus TGase family (single member, according to UniProt)
  • Structure

  • [PDB|4P8I] [Pubmed|26322858]
  • [PDB|4PA5] (complexed with cystamine) [Pubmed|26322858]
  • [SW|Localization]

  • outer spore coat, localization depends on [protein|825AD8D4315A85CD384F9AF6AD894E38E57C88F7|CotE] [Pubmed|22171814]
  • inner spore coat and cortex, dependent on [protein|CEBEC9CECCF445C40D793E61A2CD23175631A473|SafA] [pubmed|29712873]
  • Expression and Regulation

    Operons

    genes
    [gene|4A2B1DA38608E5A4096087BF7246D4C64C54DBE3|tgl]
    description
    [Pubmed|9274030]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190,12501297], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15383836], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: repression, [Pubmed|15383836], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|search|SigE], [protein|search|SigK], [protein|search|GerE]) [Pubmed|15383836,15699190,12501297]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A615 (tgl::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/615 NBRP B. subtilis, Japan]
  • 1S122 ( ''tgl''::''erm''), [Pubmed|15317760], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S122&Search=1S122 BGSC]
  • BKE31270 ([gene|4A2B1DA38608E5A4096087BF7246D4C64C54DBE3|tgl]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTAGCCCCCCTTGTT, downstream forward: _UP4_ATCGTCCGCTAAAAAGCCCC
  • BKK31270 ([gene|4A2B1DA38608E5A4096087BF7246D4C64C54DBE3|tgl]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTAGCCCCCCTTGTT, downstream forward: _UP4_ATCGTCCGCTAAAAAGCCCC
  • labs

  • [SW|Adriano Henriques], Lisbon, Portugal [http://www.itqb.unl.pt/research/biology/microbial-development homepage]
  • References

    Reviews

  • 19797877
  • Original Publications

  • 18249137,22171814,12501297,16267299,11193401,16751597,9274030,15699190,15383836,26322858,29712873,29847605,30306167,30958830