SubtiBank SubtiBank
yesM
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yesM

two-component sensor kinase
locus
BSU_06950
pI
7.28
mw
66.17 kDa
protein length
577 aa Sequence Blast
gene length
1734 bp Sequence Blast
function
unknown
product
two-component sensor kinase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.2|Protein kinases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.2|Control of two-component response regulators] → [category|SW 3.4.2.2.1|Two-component sensor kinase]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    Coordinates
    758,719 760,452

    The protein

    Catalyzed reaction/ biological activity

  • autophosphorylation, phosphorylation of [protein|F09661C8A483D0FC796204102021104A4373F895|YesN]
  • [SW|Domains]

  • two transmembrane segments, C-terminal histidine phosphotransferase domain
  • Modification

  • autophosphorylation on a His residue
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|EA17F9BBA4473C714711EB7577044402CD38B59C|yesL]-[gene|4A0961B9B760D4AA968B750ECE634B13039F9FC5|yesM]-[gene|F09661C8A483D0FC796204102021104A4373F895|yesN]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A945 (yesM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/945 NBRP B. subtilis, Japan]
  • BKE06950 ([gene|4A0961B9B760D4AA968B750ECE634B13039F9FC5|yesM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06950 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTACCAGCCAGCAACTCTTT, downstream forward: _UP4_CCGTGCCGAAATGAGGTGGT
  • BKK06950 ([gene|4A0961B9B760D4AA968B750ECE634B13039F9FC5|yesM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06950 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTACCAGCCAGCAACTCTTT, downstream forward: _UP4_CCGTGCCGAAATGAGGTGGT
  • References

  • 10094672,12850135